AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00052_aquae_reg_100.orf -o00052_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 aq_503 83 hypothetical protein #2 otnA' 30 polysaccharide biosynthesis protein (fragment) #3 metE 44 tetrahydropteroyltriglutamate methyltransferase Motif number 1 ACACATGCATTAAAAATAGGAAAAAAGCAA 1 11 0 TAAAAATAGG 0.995651 -73 TGTGTATTATTTAAAGTAGGGAGATGTATT 1 36 1 TTAAAGTAGG 0.997183 -48 AAAAGATATTTTAAAATAAGAAGTTCTAAA 3 11 1 TTAAAATAAG 0.982935 -34 TAAGAAGTTCTAAAAGGAGGAGAAATCC 3 27 1 TAAAAGGAGG 0.99521 -18 ********** Masking position 5 Map Score: 7.55958 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 54 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 TGCATTAAAAATAGGAAAAAAGCAA 1 6 0 ATAGGAAAAA 0.981029 -78 ATTATTTAAAGTAGGGAGATGTATTACACC 1 41 1 GTAGGGAGAT 0.994886 -43 GATTATGTTGTAGGGAGAATTCTTAAGAG 2 12 0 GTAGGGAGAA 0.99797 -19 AGTTCTAAAAGGAGGAGAAATCC 3 32 1 GGAGGAGAAA 0.986052 -13 ********** Masking position 3 Map Score: 4.49909 Number of sites scoring better than the average of aligned sites = 198 Number in coding regions = 180 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 TTTCCTATTTTTAATGCATGTGTATTATTTA 1 18 1 TTAAGCATGT 0.974484 -66 CCGAAAAGGTGTAATACATCTCCCTACTTTA 1 47 0 GTAAACATCT 0.992616 -37 GCTCTTAAGAATTCTCCCTACAACA 2 5 1 TTAAAATTCT 0.981124 -26 ACTTCTTATTTTAAAATATCTTTT 3 4 0 TTAAATATCT 0.986864 -41 TCTCCTCCTTTTAGAACTTCTTATTTTAAAA 3 19 0 TTAGACTTCT 0.989452 -26 **** ****** Masking position 3 Map Score: 4.21897 Number of sites scoring better than the average of aligned sites = 168 Number in coding regions = 145 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 TTAAAAATAGGAAAAAAGCAA 1 2 0 GAAAAAAGCA 0.965075 -82 ACACCTTTTCGGAGACAGCAGGTTTGCT 1 66 1 GGAGACAGCA 0.996079 -18 TATGTTGTAGGGAGAATTCTTAAGAGC 2 8 0 GGAGAATTCT 0.982774 -23 TCTAAAAGGAGGAGAAATCC 3 35 1 GGAGAAATCC 0.987085 -10 ********** Masking position 5 Map Score: 3.49408 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 154 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 5 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0