AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00960_aquae_reg_100.orf -o00960_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 glgP 110 glycogen phosphorylase #2 speC 35 ornithine decarboxylase Motif number 1 AAAACTGCTTACACAGGCGGCTTCTGTCCC 1 39 1 ACACAGGCGG 0.992629 -72 CGCGTATCTATGATACGGGGACAGAAGCCG 1 56 0 TGATACGGGG 0.994245 -55 CCCGTATCATAGATACGCGGTTTTAGCCCG 1 67 1 AGATACGCGG 0.999146 -44 ATTTTATAGTAAATCCGCGGGCTAAAACCG 1 84 0 AAATCCGCGG 0.996041 -27 ********** Masking position 3 Map Score: 5.44361 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 45 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CCTCACAAGATTCATTTTAAAAAACTGCTT 1 19 1 TTCATTTTAA 0.895869 -92 CTGTCCCCGTATCATAGATACGCGGTTTTA 1 62 1 ATCATAGATA 0.957265 -49 TACTTGTATTTTATAGTAAATCCGCGGGC 1 92 0 TTTATAGTAA 0.892299 -19 TATAAATACTTTTATAGATATTTGCT 2 7 0 TTTATAGATA 0.922983 -29 TATAAAAGTATTTATATTTATCGGA 2 21 1 TTTATATTTA 0.885154 -15 ********** Masking position 5 Map Score: 5.11474 Number of sites scoring better than the average of aligned sites = 183 Number in coding regions = 156 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 GCCGCCTGTGTAAGCAGTTTTTTAAAATGA 1 30 0 TAAGCAGTTT 0.978437 -81 ACTGCTTACACAGGCGGCTTCTGTCCCCGT 1 42 1 CAGGCGGCTT 0.989421 -69 GTATCATAGATACGCGGTTTTAGCCCGCGG 1 70 1 TACGCGGTTT 0.995884 -41 TTATAGTAAATCCGCGGGCTAAAACCGCGT 1 81 0 TCCGCGGGCT 0.993004 -30 ********** Masking position 10 Map Score: 2.6055 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 84 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0