AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00271_aful_reg_100.orf -o00271_aful_100.ace -a/home/amcguire/genomes/ORF_aful.txt -z/home/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 AF1452 117 signal-transducing histidine kinase #2 AF1453 37 methionyl-tRNA synthetase (metS) #3 AF2113 44 A. fulgidus predicted coding region AF2113 Motif number 1 AATTTTTGTTTTGGTTACCTGTAAAGCGTATTTG 1 16 1 TTGTACTGAA 0.992269 -102 GTAAAGCGTATTTGCTGGCGGCAGTTTTTTGGAA 1 36 1 TTGCGGGGAG 0.976502 -82 ATTTGGCCGATTATTCAGATGCAATCCATTCCAA 1 64 0 TTTTAGTGAA 0.988145 -54 GAGGGAAAAGGTTGCGAGGGGTAAATAACGTTTT 2 13 0 GTGCAGGGAA 0.991502 -25 TTTGTCAGGTGCAAAATTTTTTAA 3 1 1 TTGTAGTGAA 0.995958 -44 GGTGCAAAATTTTTTAACAGGAAAATAACTCAAT 3 18 1 TTTTACGGAA 0.985184 -27 ** ** ** ** ** Masking position 2 Map Score: 5.05212 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 118 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 ACGCTTTACAGGTAACCAAAACAAAAATTA 1 15 0 GGTAACCAAA 0.975696 -103 TGCCTATCTTTGTAAATAAAAGCATTTGGC 1 91 0 TGTAAATAAA 0.984817 -27 GGTTGCGAGGGGTAAATAACGTTTTAC 2 8 0 GGTAAATAAC 0.99249 -30 GTTATTTTCCTGTTAAAAAATTTTGCACCT 3 17 0 TGTTAAAAAA 0.890367 -28 TTTTTTAACAGGAAAATAACTCAATTAT 3 27 1 GGAAAATAAC 0.980286 -18 ********** Masking position 5 Map Score: 4.76409 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 57 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 GGCCGATTATTCAGATGCAATCCATTCCAA 1 64 0 TCAGATGCAA 0.996869 -54 TTTGTCAGGTGCAAAATTTTTTAA 3 5 1 TCAGGTGCAA 0.998084 -40 ********** Masking position 6 Map Score: 1.61308 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0