AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00630_aful_reg_300.orf -o00630_aful_300.ace -a/home/amcguire/genomes/ORF_aful.txt -z/home/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 AF1342 126 thymidine phosphorylase (deoA-2) #2 AF1588 51 conserved hypothetical protein #3 AF1590 300 A. fulgidus predicted coding region AF1590 #4 AF1638 31 ribulose bisphosphate carboxylase, large subunit (rbcL-2) Motif number 1 TTTAAAAATTCTCACCTGAAAAGGTTTTAA 1 32 0 CTCACCTGAA 0.943568 -95 CACTTCTTTGCTCCCGAGAACTCACAAAAA 3 54 1 CTCCCGAGAA 0.984 -247 CTCCCGAGAACTCACAAAAAAGACGGTTTC 3 64 1 CTCACAAAAA 0.968011 -237 GAGTAAAAATCTCCCTAAAATCGCATGGGT 3 94 1 CTCCCTAAAA 0.991008 -207 CAATAAAGGTCTCACCAAATTCCGCAATAA 3 144 0 CTCACCAAAT 0.981239 -157 TAATTTTATCCTCCCTAAGTTTTCCCGCTC 3 215 1 CTCCCTAAGT 0.936518 -86 CCGCTCGCTTCCCCCCAAAACTAGGGTAGA 3 239 1 CCCCCCAAAA 0.987081 -62 ********** Masking position 5 Map Score: 8.10784 Number of sites scoring better than the average of aligned sites = 247 Number in coding regions = 222 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 AATTCTCACCTGAAAAGGTTTTAAAGCTGA 1 26 0 TGAAAAGGTT 0.975213 -101 AAGAAGTTATAGATAATGTTGTTTATGTTT 1 59 0 AGATAATGTT 0.935155 -68 CTCGCTATCGTGAAGAAGTTATAGATAATG 1 71 0 TGAAGAAGTT 0.967965 -56 CACGATAGCGAGAAAAAGTTAATATTCTTT 1 89 1 AGAAAAAGTT 0.985505 -38 TCGGGAGCAAAGAAGTGGTTGCTTGAAGCC 3 41 0 AGAAGTGGTT 0.937553 -260 CTAAGGAGGTAAATAAAGTT 4 1 0 AAATAAAGTT 0.849232 -31 ********** Masking position 3 Map Score: 3.68389 Number of sites scoring better than the average of aligned sites = 285 Number in coding regions = 260 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 AATTGTCGTCAGCTTTAAAACCTTTTCAGGTGAGA 1 18 1 AGTTAACTTT 0.96178 -109 AATGTTGTTTATGTTTAAAAATTCTCACCTGAAAA 1 40 0 ATTTAATTCT 0.848336 -87 TAGCGAGAAAAAGTTAATATTCTTTCAGAGTTTTT 1 94 1 AATTAACTTT 0.985662 -33 TGAACTTCAAAAACTCTGAAAGAATAT 1 110 0 AATTAACTCT 0.988097 -17 TTGTGTCAGCAAATATAAAGATTTTGATTTAATGT 2 17 0 AATAAATTTT 0.890087 -35 AAGCCTCTACAAATTGATTGGCTTTATTTCTCGCC 3 11 0 AATTATCTTT 0.933386 -290 GGGAGGATAAAATTAAAGAAACTCTTTGTAAGCCA 3 195 0 AATAAACTCT 0.973073 -106 ** ** * * **** Masking position 7 Map Score: 2.86832 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 75 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 TTAACTTTTTCTCGCTATCGTGAAGAAGTT 1 81 0 CTCGCTATCG 0.992338 -46 GAGATTTTTACTCGAAACCGTCTTTTTTGT 3 77 0 CTCGAAACCG 0.97502 -224 AGTTTTCCCGCTCGCTTCCCCCCAAAACTA 3 232 1 CTCGCTTCCC 0.983854 -69 GAGTGATGGTCCCTCTACCCTAGTTTTGGG 3 252 0 CCCTCTACCC 0.975658 -49 TTAATCTTGACTCTCAATAGTAGAAAAGAG 3 279 0 CTCTCAATAG 0.884756 -22 ********** Masking position 3 Map Score: 0.739044 Number of sites scoring better than the average of aligned sites = 524 Number in coding regions = 507 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 5 AGGTTTTAAAGCTGACGACAATTTAACATC 1 11 0 GCTGACGACA 0.974133 -116 CTTCAAAAACTCTGAAAGAATATTAACTTT 1 103 0 TCTGAAAGAA 0.884004 -24 CTTTATATTTGCTGACACAACCCCAAATTT 2 32 1 GCTGACACAA 0.977238 -20 AAGGGAAGCAGCTGAACCCATGCGATTTTA 3 109 0 GCTGAACCCA 0.981026 -192 CCGCAATAATGCTGAAGGGAAGCAGCTGAA 3 123 0 GCTGAAGGGA 0.981026 -178 ********** Masking position 5 Map Score: 0.412685 Number of sites scoring better than the average of aligned sites = 440 Number in coding regions = 406 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 6 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0