AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00130_bbur_reg_100.orf -o00130_bbur_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 BB0314 50 octaprenyl-diphosphate synthase (ispB) #2 BB0590 36 dimethyladenosine transferase (ksgA) #3 BB0591 115 competence locus E, putative #4 BB0709 300 conserved hypothetical protein Motif number 1 ATACACTTTATTATACTTTTTCATTATAATT 1 24 1 TTATACTTTT 0.950669 -27 TACTTTTTCATTATAATTCTTATT 1 37 1 TTATAATTTT 0.986261 -14 GACAGATATTTTAAAATTATT 2 1 0 TTAAAATTTT 0.925667 -36 ATTATTCTTAATAATGACAGAT 2 25 0 TTATTCTTAT 0.893006 -12 CGTTGACAATTAATAATTATTTAATTACAAT 3 16 0 TAATAATTTT 0.876014 -100 TGTCAACGAATGATTATTGATTGATTAATCA 3 39 1 TGATTATTAT 0.819339 -77 ATATTTTGAATTTTAATTTGTTTTGATTAAT 3 62 0 TTTTAATTGT 0.94082 -54 AAAATTCAAAATATAATTATTTATAAATAAA 3 79 1 ATATAATTTT 0.930863 -37 AATATTCTTATTTTTATTTATAAATAATTAT 3 91 0 TTTTTATTAT 0.941219 -25 TTATAATATTCTTATTTTTATTT 3 103 0 ATAATATTTT 0.61309 -13 GTTTGCCTTTTTATAATTTTTATTGTGATCT 4 122 1 TTATAATTTT 0.98626 -179 CATTTTGGTGCTTTTATTTTTGTCTATTTAG 4 174 1 CTTTTATTTT 0.798078 -127 TTTAGAAAAGTTATTATTGGTTATAAAATAT 4 200 1 TTATTATTGT 0.954381 -101 CAATTAAAATTTTTAATTGATAGCTAACATC 4 231 0 TTTTAATTAT 0.959391 -70 CAATTAAAAATTTTAATTGATAGCTAAAGTG 4 243 1 TTTTAATTAT 0.959391 -58 ******** ** Masking position 7 Map Score: 21.4472 Number of sites scoring better than the average of aligned sites = 1673 Number in coding regions = 1037 Number in noncoding regions = 636 Number of orfs with sites within 600 bp upstream = 138 Fraction of orfs with sites within 600 bp upstream = 0.0221651 Motif number 2 AATTTTTAATTGATAGCTAACATCATATTT 4 225 0 TGATAGCTAA 0.990785 -76 AAATTTTAATTGATAGCTAAAGTGTAATTA 4 250 1 TGATAGCTAA 0.990785 -51 TAAACAAAAGTCTTTGCTAATTACACTTTA 4 267 0 TCTTTGCTAA 0.960249 -34 AAGAATCTCCTAGCTAAACAAAAGTCT 4 284 0 TCCTAGCTAA 0.989066 -17 ********** Masking position 4 Map Score: 4.03789 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 5 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 AATAATTTTAAAATATCTGTCATTATTA 2 7 1 TTAAAATATT 0.952708 -30 CAAATTAAAATTCAAAATATAATTATTTATAA 3 73 1 TTAAAATATA 0.97855 -43 AAGATCACAATAAAAATTATAAAAAGGCAAAC 4 122 0 TAAAATTATA 0.76742 -179 ACATAACACATTTAAAAGATCACAATAAAAAT 4 137 0 TTAAAAGATA 0.968906 -164 TTTGTCTATTTAGAAAAGTTATTATTGGTTAT 4 192 1 TAAAAAGTTT 0.819125 -109 TATTATTGGTTATAAAATATGATGTTAGCTAT 4 211 1 TAAAAATATA 0.972628 -90 TAGCTATCAATTAAAAATTTTAATTGATAGCT 4 236 1 TTAAAATTTA 0.851261 -65 ** ******* * Masking position 6 Map Score: 5.40459 Number of sites scoring better than the average of aligned sites = 824 Number in coding regions = 551 Number in noncoding regions = 273 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 4 AGTATAATAAAGTGTATTAAAGGGATTGAT 1 11 0 AGTGTATTAA 0.94257 -40 ATAATGAAAAAGTATAATAAAGTGTATTAA 1 21 0 AGTATAATAA 0.95741 -30 AAAGTATTGTAATTAAATAATTATT 3 6 1 ATTGTAATTA 0.959654 -110 TAAAATTCAAAATATAATTATTTATAAATA 3 78 1 AATATAATTA 0.889344 -38 TCCCCAATTTAGTGAAATTATAAGCGTTTG 4 97 1 AGTGAAATTA 0.968377 -204 TGATAGCTAAAGTGTAATTAGCAAAGACTT 4 260 1 AGTGTAATTA 0.992008 -41 ********** Masking position 6 Map Score: 6.55759 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 34 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: 1.44541e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.44541e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.44541e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0