AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00730_bsub_reg_100.orf -o00730_bsub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 thiD 148 phosphomethylpyrimidine kinase #2 ywbI 105 alternate gene name: ipa-24d; similar to transcriptional regulator (LysR family) Motif number 1 AAATGCTACATAAGAAAACTAGGTAGGGGTTTTGA 1 15 0 TAGAACAGTA 0.991691 -134 TGTATCACAATATATAGAAGATCTATAGGAATCAT 1 75 0 TAAAAAACTA 0.970887 -74 TATATTGTGATACAGAGAAAATCTAACTATAATGA 1 96 1 TAAAAAACTA 0.985639 -53 AGAGAGACCTTATGTACAATAAGTATATAAGGGAG 2 19 0 TAGAAAAGTA 0.990485 -87 GGTCTCTCTATAGGTAAAATATATATTAAGAATAA 2 45 1 TAGAAAAATA 0.843008 -61 AAATATATATTAAGAATAAGAAGTATTCCTTTTGT 2 61 1 TAGAAAAGTA 0.997389 -45 TCACCCTTTCTATAGACAAAAGGAATACTTCTTAT 2 76 0 TAAAAAAGAA 0.975202 -30 ** * * ** * *** Masking position 8 Map Score: 12.8994 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 31 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 TTTCTCTGTATCACAATATATAGAAGATCT 1 86 0 TCACAATATA 0.935769 -63 ACAGAGAAAATCTAACTATAATGAAAGACA 1 107 1 TCTAACTATA 0.964853 -42 ATTGATGCCTCCCTTATATACTTATTGTAC 2 11 1 CCCTTATATA 0.943128 -95 GTACATAAGGTCTCTCTATAGGTAAAATAT 2 37 1 TCTCTCTATA 0.986787 -69 TACTTCTTATTCTTAATATATATTTTACCT 2 56 0 TCTTAATATA 0.977857 -50 GCGCTTCACCCTTTCTATAGACAAAAGGA 2 87 0 CCTTTCTATA 0.983013 -19 ********** Masking position 7 Map Score: 6.5583 Number of sites scoring better than the average of aligned sites = 148 Number in coding regions = 103 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 GAGATTGTCAAATGATTCCTATAGATCTTC 1 64 1 AATGATTCCT 0.993057 -85 ATTGATGCCTCCCTTATATA 2 1 1 ATTGATGCCT 0.98634 -105 TAAGAATAAGAAGTATTCCTTTTGTCTATA 2 71 1 AAGTATTCCT 0.968168 -35 ********** Masking position 5 Map Score: 0.640166 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 78 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 ********** No masking Map Score: -1.1836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.1836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.1836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0