AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00562_synecho_reg_100.orf -o00562_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 sll0776 77 probable serine/threonine-protein kinase sll0776. [EC:2.7.1.-] #2 sll0775 222 merR; hypothetical protein. Motif number 1 TTTTTTACAGTTCAATTGATTGAATTAAAGTTGAATTTA 1 12 1 TTGTTATAAA 0.958956 -66 AATCAAAAAATTGAAATACTTAAATTCAACTTTAATTCA 1 32 0 TTATTATCAA 0.968449 -46 AGTATTTCAATTTTTTGATTTTAGATAAACAAACAAC 1 51 1 TTATTGTAAA 0.948545 -27 TGCTATCCCATTGACTAATTTTGGTGAAATTAACTTTAA 2 17 1 TTATTGGAAA 0.817874 -206 TTTATCTGGATTTTGGTAGTACTGTTAAAGTTAATTTCA 2 41 0 TTATAGTAAA 0.977021 -182 TCAGGACTCTTTTATTAACTTTCGTTAAAGCCGTTTTCC 2 121 0 TTATTGTAAA 0.848234 -102 TATAGGAATATTACCCTAGTTTTACGAAAAGGATCTCAT 2 164 0 TTATTAGAAA 0.971737 -59 ** * ** * **** Masking position 18 Map Score: 7.16387 Number of sites scoring better than the average of aligned sites = 85 Number in coding regions = 63 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 AATTCAACTTTAATTCAATCAATTGAACTGTAAAAAA 1 12 0 TATCAACAAA 0.92595 -66 GTTGTTTGTTTATCTAAAATCAAAAAATTGAAATACT 1 51 0 TACAAATAAA 0.991851 -27 AAAGTTAATTTCACCAAAATTAGTCAATGGGATAGCA 2 17 0 TCCAAATAAA 0.99015 -206 TTAACAGTACTACCAAAATCCAGATAAATTTTCTTCC 2 52 1 TACAAACAAA 0.990215 -171 AAAACGGCTTTAACGAAAGTTAATAAAAGAGTCCTGA 2 123 1 TACAAATAAA 0.991809 -100 GAGATCCTTTTCGTAAAACTAGGGTAATATTCCTATA 2 166 1 TCTAAATGAA 0.925533 -57 ** * *** * * ** Masking position 8 Map Score: 2.14812 Number of sites scoring better than the average of aligned sites = 89 Number in coding regions = 70 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 3 TGACTATGCTATCCCATTGACTAATTTTG 2 10 1 TATCCCATTG 0.98569 -213 TTCTTCCGTTTTTCCCTTTGCTCCATGGCG 2 82 1 TTTCCCTTTG 0.995353 -141 GTTAAAGCCGTTTTCCTTAGGCGATCGCCA 2 107 0 TTTTCCTTAG 0.978037 -116 ********** Masking position 3 Map Score: 0.915385 Number of sites scoring better than the average of aligned sites = 120 Number in coding regions = 101 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 4 TTCACCAAAATTAGTCAATGGGATAGCATAGT 2 13 0 TTATCAAGGG 0.980307 -210 GCGATCGCCATGGAGCAAAGGGAAAAACGGAA 2 85 0 TGGGCAAGGG 0.9888 -138 GGCGATCGCCTAAGGAAAACGGCTTTAACGAA 2 108 1 TAAGAAACGG 0.898266 -115 TTAACGAAAGTTAATAAAAGAGTCCTGACGGA 2 132 1 TTATAAAGAG 0.938754 -91 AAAAGAGTCCTGACGGAATGAGATCCTTTTCG 2 147 1 TGAGGAAGAG 0.98107 -76 TACCCTAGTTTTACGAAAAGGATCTCATTCCG 2 160 0 TTAGAAAGGA 0.947237 -63 TTTGTCTGTATGAGGCAACGATACGGCT 2 205 1 TGAGCAAGAT 0.95554 -18 *** **** *** Masking position 7 Map Score: 2.39378 Number of sites scoring better than the average of aligned sites = 1023 Number in coding regions = 886 Number in noncoding regions = 137 Number of orfs with sites within 600 bp upstream = 146 Fraction of orfs with sites within 600 bp upstream = 0.02345 Motif number 5 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0