AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00100_ecoli_reg_100.orf -o00100_ecoli_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.51 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.51 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 caiA 30 probable carnitine operon oxidoreductase #2 caiT 300 probable carnitine transporter #3 mhpA 76 3-(3-hydroxyphenyl)propionate hydroxylase #4 xseB 205 exonuclease VII, small subunit #5 pepP 25 proline aminopeptidase P II #6 ygfB 161 orf, hypothetical protein Motif number 1 TGATCCATAAAACAATATTGAAAATTTCTTTTTGC 2 15 0 AAATATTGAT 0.987428 -286 TTTATGGATCACCAATATTGAAAGTCAGATGTTAT 2 39 1 AAATATTGAT 0.987428 -262 GTTAATTTTGATTAATAATCAGTTTGTTATGCTCT 2 88 0 AAATAATCAT 0.959119 -213 CCACGAGGTTAATAATAATTATATTAAATGTTAAC 2 218 1 AAATAATTAT 0.937834 -83 CACTGTGAAAACGAATATTTATTTTGCGTTCCCGT 2 266 0 AAATATTTAT 0.971977 -35 TGACGGGGCGAAAAATATTGAGAGTCAGACATTCA 4 179 1 AAATATTGAT 0.987428 -27 CGTCAAAGGGAGGAATATTCATGATATGCTACCAC 6 133 0 AAATATTCAT 0.981649 -29 * ******** * Masking position 7 Map Score: 8.62183 Number of sites scoring better than the average of aligned sites = 63 Number in coding regions = 42 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 GTTATGCTCTGTTGTGAGTAAAAAATAACATCTGACTTT 2 59 0 GTGGAAAAAC 0.990403 -242 ACAAAATGTCGTTGCGCGCACAGTACAGCGCAACTTATT 3 28 0 GTGGAAAAGC 0.998547 -49 TAAGCGACTTGTATAGGGAAAAATACAGCAGCCCACACC 4 37 1 GTGGAAAAGC 0.998548 -169 CAATGGTAAGGTGATGTGCACAGCAAAGCGATGTTAGTG 4 105 0 GTGGAAAAGC 0.998521 -101 CATGGTCTGCGAAGGGGCGACACTATAGCTACCCTGATG 6 55 1 GAGCAAAAGC 0.974939 -107 TATAGCTACCCTGATGAGAAGAGACAAGCCCTTTTCTGG 6 78 1 CTGGAACAGC 0.982952 -84 ** * * * * * *** Masking position 10 Map Score: 6.16341 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 33 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 CGTAGCAAAAAGAAATTTTCAA 2 3 1 TAGCAAAAAG 0.885741 -298 CTGTTGTGAGTAAAAAATAACATCTGACTT 2 60 0 TAAAAAATAA 0.690448 -241 TAATCAAAATTAACGAAAAAACGCCCTCTA 2 109 1 TAACGAAAAA 0.954957 -192 TATTCACCCGAAACAAAAATGTGATACCAA 2 137 1 AAACAAAAAT 0.934135 -164 TATTAAATGTTAACAAAAATAAAACAAACG 2 239 1 TAACAAAAAT 0.964332 -62 TCCACTGTGAAAACGAATATTTATTTTGCG 2 273 0 AAACGAATAT 0.784321 -28 TACATGTTTTTAACAAAATAAGTTGCGCTG 3 12 1 TAACAAAATA 0.872406 -65 TCAGGGCAAATAGCAAATAACGCGCAATGG 4 138 0 TAGCAAATAA 0.9175 -68 AAACAAAAAACGTAAGGAGA 5 1 1 AAACAAAAAA 0.957898 -25 ********** Masking position 6 Map Score: 6.15149 Number of sites scoring better than the average of aligned sites = 477 Number in coding regions = 309 Number in noncoding regions = 168 Number of orfs with sites within 600 bp upstream = 174 Fraction of orfs with sites within 600 bp upstream = 0.0279473 Motif number 4 ATGAGTTAGCCATTAACGCGTCCACGAGGT 2 197 1 CATTAACGCG 0.926272 -104 GTTGCGCGCACAGTACAGCGCAACTTATTT 3 27 0 CAGTACAGCG 0.96161 -50 CCTGCGGCTGCATCCAGGCGCGGAAGTATA 4 74 1 CATCCAGGCG 0.952721 -132 GTGATGTGCACAGCAAAGCGATGTTAGTGG 4 104 0 CAGCAAAGCG 0.990062 -102 AGTCCGTTACCATGACGGGGCGAAAAATAT 4 167 1 CATGACGGGG 0.957376 -39 AGTCAATCAGCAGGAAGGTGGC 6 3 0 CAGGAAGGTG 0.940584 -159 CCTGGTGGACCAGAAAAGGGCTTGTCTCTT 6 96 0 CAGAAAAGGG 0.950251 -66 TCGTCGTCAAAGGGAGGAATATTC 6 148 0 CGTCAAAGGG 0.927045 -14 ********** Masking position 8 Map Score: 3.99729 Number of sites scoring better than the average of aligned sites = 1500 Number in coding regions = 1406 Number in noncoding regions = 94 Number of orfs with sites within 600 bp upstream = 108 Fraction of orfs with sites within 600 bp upstream = 0.0173466 Motif number 5 CTTATTGAATACCCATTATGAGTTAGCCAT 2 180 1 ACCCATTATG 0.929979 -121 CTTGCCAACGAACCATTGCCGCC 4 4 0 AACCATTGCC 0.953579 -202 CACATCACCTTACCATTGCGCGTTATTTGC 4 126 1 TACCATTGCG 0.975019 -80 CTGAGTCCGTTACCATGACGGGGCGAAAAA 4 164 1 TACCATGACG 0.975019 -42 TCGTCTTTAGACCCATGGTCTGCGAAGGGG 6 42 1 ACCCATGGTC 0.930534 -120 ACACTATAGCTACCCTGATGAGAAGAGACA 6 74 1 TACCCTGATG 0.901855 -88 ********** Masking position 6 Map Score: 0.865386 Number of sites scoring better than the average of aligned sites = 425 Number in coding regions = 401 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 6 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0