AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00053_hpyl_reg_100.orf -o00053_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 HP1483 26 gerC2 protein (gerC2) #2 HP1490 103 hemolysin Motif number 1 AGACAAGCCATGAAAAAAGAAAAGTC 1 8 1 CCTAAAAAAA 0.976781 -19 ATTAAGCCTAACTTTAAAAATCAAGCCTTCAAAA 2 14 0 ACTAAAATAA 0.99786 -90 CAGAATTTTAACATAAAAGATTAAGCCTAACTTT 2 33 0 ACTAAAATAA 0.99786 -71 AATATAAAATATATAAAATCTCAGAATTTTAACA 2 54 0 ATTAAACTAG 0.956261 -50 CTAAAACCTAACGATAAATATAAAATATATAAAA 2 70 0 ACAAAAATAA 0.991377 -34 AACTTTAAACCTAAAACCTAACGAT 2 89 0 ACTAAACTAA 0.99742 -15 ** * *** ** ** Masking position 7 Map Score: 10.3678 Number of sites scoring better than the average of aligned sites = 68 Number in coding regions = 54 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 GGTTTTTGAAGGCTTGATTTTTAAAGTTAG 2 9 1 AAGGCTTATT 0.986558 -95 TTTTTAAAGTTAGGCTTAATCTTTTATGTTAA 2 28 1 TAGGCTTATT 0.995882 -76 CTTAATCTTTTATGTTAAAATTCTGAGATTTT 2 42 1 TATGTTAAAT 0.92232 -62 TGAGATTTTATATATTTTATATTTATCGTTAG 2 65 1 TATATTTATT 0.950129 -39 TATTTATCGTTAGGTTTTAGGTTTAAAGTT 2 84 1 TAGGTTTAGT 0.992447 -20 ******* ** * Masking position 6 Map Score: 3.00123 Number of sites scoring better than the average of aligned sites = 177 Number in coding regions = 140 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 GCTTGATTTTTAAAGTTAGGCTTAATCTTT 2 22 1 TAAAGTTAGG 0.994863 -82 ATTTTATATTTATCGTTAGGTTTTAGGTTT 2 78 1 TATCGTTAGG 0.996515 -26 ********** Masking position 6 Map Score: 0.698585 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 6 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0