AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00340_mgen_reg_300.orf -o00340_mgen_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MG035 28 histidyl-tRNA synthetase #2 MG466 25 ribosomal protein L34 (rpL34) #3 MG468.1 62 ABC transporter, ATP-binding protein #4 MG469 300 chromosomal replication initiator protein (dnaA) Motif number 1 GTCATTAATTATAATTTCGAAATTAT 1 5 0 AAATTTCGAA 0.970007 -24 CAAAATTAAAATTTTCTAATAGTGTTCTCA 3 9 1 AATTTTCTAT 0.922222 -54 AAAAAGAGAGATATTTTCAAGAGGAACAAAAT 4 16 1 AATTTTCAAA 0.994706 -285 AAGAGGAACAAAATTTTCAATATCATAATAAT 4 34 1 AATTTTCAAA 0.994706 -267 AAAAAAATCAAAATTTTCAACAACAATTCACA 4 79 1 AATTTTCAAA 0.994706 -222 ATGATAGTTAAAATTCTCGAAATTGGGATATT 4 255 0 AATTCTCGAA 0.982747 -46 TTCTTCTATAACATTGTCAAGAATGATAGTTA 4 277 0 AATTGTCAAA 0.985654 -24 * ******** * Masking position 3 Map Score: 11.9393 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 21 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 ATTAAGTCATCTAAAAAAATACCCTGAGAAC 3 34 0 CTAAAAAATA 0.834401 -29 ACCAAAAAAAGAGAGATATTTTCAAGAG 4 8 1 AAAGAGGATA 0.851627 -293 GAGATATTTTCAAGAGGAACAAAATTTTCAA 4 23 1 CAAGAGAACA 0.980863 -278 TTTCTTACAGCAAAAAAATCAAAATTTTCAA 4 68 1 CAAAAAATCA 0.734273 -233 TCAAAATTTTCAACAACAATTCACACAACCA 4 86 1 CAACAAAATT 0.948699 -215 CCCCAACCTAAAACAAAAATACCAGGAATAG 4 129 1 AAACAAAATA 0.92015 -172 TCTTGGCGTTCAACAGGAACTATTCCTGGTA 4 148 0 CAACAGAACT 0.934492 -153 TGTTGAACGCCAAGAAAAACTAGATACAGGT 4 164 1 CAAGAAAACT 0.970235 -137 ATAACATTGTCAAGAATGATAGTTAAAATTC 4 271 0 CAAGAAGATA 0.966182 -30 TGACAATGTTATAGAAGAATA 4 290 1 ATAGAAAATA 0.839011 -11 ****** **** Masking position 5 Map Score: 7.91906 Number of sites scoring better than the average of aligned sites = 512 Number in coding regions = 476 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 AAACAATTAATCAGGTGATTATAA 2 5 0 TCAGGTGATT 0.949787 -21 AATAGTGTTCTCAGGGTATTTTTTTAGATG 3 28 1 TCAGGGTATT 0.991344 -35 GAAACCATTATTATGATATTGAAAATTTTG 4 42 0 TTATGATATT 0.935835 -259 CAGGAACTATTCCTGGTATTTTTGTTTTAG 4 136 0 TCCTGGTATT 0.967549 -165 ATTCTCGAAATTGGGATATTAACTGCTTTG 4 245 0 TTGGGATATT 0.95068 -56 ********** Masking position 8 Map Score: 1.16792 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 19 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 AATCACCTGATTAATTGTTTC 2 15 1 TTAATTGTTT 0.954438 -11 AGATGACTTAATGATTGTTT 3 53 1 ATGATTGTTT 0.988772 -10 CAATATCATAATAATGGTTTCTTACAGCAA 4 51 1 ATAATGGTTT 0.946249 -250 GTTGAAAATTTTGATTTTTTTGCTGTAAGA 4 70 0 TTGATTTTTT 0.87955 -231 TATTCCTGGTATTTTTGTTTTAGGTTGGGG 4 129 0 ATTTTTGTTT 0.845408 -172 ATTGTCAAGAATGATAGTTAAAATTCTCGA 4 267 0 ATGATAGTTA 0.868483 -34 ********** Masking position 5 Map Score: 2.61039 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 175 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 TAATTATAATTTCGAAATTAT 1 2 0 TTCGAAATTA 0.982005 -27 GAGAACACTATTAGAAAATTTTAATTTTG 3 10 0 TTAGAAAATT 0.906928 -53 TTTTGTTCCTCTTGAAAATATCTCTCTTTT 4 17 0 CTTGAAAATA 0.937783 -284 TGACAAAAAGTTAGAAATTACTCCAAAGCA 4 222 1 TTAGAAATTA 0.972436 -79 AGTTAAAATTCTCGAAATTGGGATATTAAC 4 252 0 CTCGAAATTG 0.971875 -49 ********** Masking position 5 Map Score: 2.53416 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 13 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 ********** No masking Map Score: -8.92852e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.92852e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -8.92852e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0