AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00930_mjan_reg_100.orf -o00930_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MJ0140 138 conserved hypothetical protein Motif number 1 TGTCAAGTTAAGTTTTTATTAAATATTGATAAAA 1 22 0 AGTTATTAAT 0.982 -117 TTAACTTGACAGTCCCTATAATAAGTTTTAAAAT 1 45 1 AGTTATAAAA 0.989092 -94 AGTTAGAACAAGTGAATTTTAAAACTTATTATAG 1 60 0 AGTTTTTAAA 0.988913 -79 TATTAGATATAGTGAATATTATATTAGAGTTAGA 1 87 0 AGTTATTAAT 0.994579 -52 ATAGTTAGAAAGTATTTATTAGATATAGTGAATA 1 103 0 AGTTATTAAT 0.997611 -36 *** ***** ** Masking position 7 Map Score: 10.1929 Number of sites scoring better than the average of aligned sites = 63 Number in coding regions = 41 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 TAAATATTGATAAAAAATAATAAACT 1 6 0 TAAAAAAAAT 0.939547 -133 TAAGTTTTTATTAAATATTGATAAAAAATAA 1 17 0 TTAAATATGA 0.897796 -122 CAATATTTAATAAAAACTTAACTTGACAGTC 1 28 1 TAAAAACTAA 0.898423 -111 CAAGTGAATTTTAAAACTTATTATAGGGACT 1 55 0 TTAAAACTAT 0.974406 -84 TATATTAGAGTTAGAACAAGTGAATTTTAAA 1 71 0 TTAGAACAGT 0.966585 -68 GTTCTAACTCTAATATAATATTCACTATATC 1 85 1 TAATATATAT 0.825278 -54 AAAGTATTTATTAGATATAGTGAATATTATA 1 98 0 TTAGATAAGT 0.948442 -41 CCTCCCATAGTTAGAAAGTATTTATTAGATA 1 112 0 TTAGAAATAT 0.979665 -27 ******* *** Masking position 5 Map Score: 7.19178 Number of sites scoring better than the average of aligned sites = 1368 Number in coding regions = 1073 Number in noncoding regions = 295 Number of orfs with sites within 600 bp upstream = 262 Fraction of orfs with sites within 600 bp upstream = 0.0420816 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0