AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00930_mjan_reg_300.orf -o00930_mjan_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MJ0140 138 conserved hypothetical protein Motif number 1 TGTCAAGTTAAGTTTTTATTAAATATTGATAAAA 1 22 0 AGTTATTAAT 0.98073 -117 TTAACTTGACAGTCCCTATAATAAGTTTTAAAAT 1 45 1 AGTTATAAAA 0.99005 -94 AGTTAGAACAAGTGAATTTTAAAACTTATTATAG 1 60 0 AGTTTTTAAA 0.989853 -79 TATTAGATATAGTGAATATTATATTAGAGTTAGA 1 87 0 AGTTATTAAT 0.994486 -52 ATAGTTAGAAAGTATTTATTAGATATAGTGAATA 1 103 0 AGTTATTAAT 0.997812 -36 *** ***** ** Masking position 7 Map Score: 10.1929 Number of sites scoring better than the average of aligned sites = 63 Number in coding regions = 41 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 AGTTTATTATTTTTTATCAATATTTA 1 6 1 ATTTTTTTTA 0.93727 -133 TTATTTTTTATCAATATTTAATAAAAACTTA 1 17 1 TCATATTTAA 0.894248 -122 GACTGTCAAGTTAAGTTTTTATTAAATATTG 1 28 0 TTAGTTTTTA 0.894848 -111 AGTCCCTATAATAAGTTTTAAAATTCACTTG 1 55 1 ATAGTTTTAA 0.973461 -84 TTTAAAATTCACTTGTTCTAACTCTAATATA 1 71 1 ACTGTTCTAA 0.965289 -68 GATATAGTGAATATTATATTAGAGTTAGAAC 1 85 0 ATATATATTA 0.819525 -54 TATAATATTCACTATATCTAATAAATACTTT 1 98 1 ACTTATCTAA 0.946481 -41 TATCTAATAAATACTTTCTAACTATGGGAGG 1 112 1 ATATTTCTAA 0.978869 -27 *** ******* Masking position 11 Map Score: 7.19178 Number of sites scoring better than the average of aligned sites = 1368 Number in coding regions = 1073 Number in noncoding regions = 295 Number of orfs with sites within 600 bp upstream = 262 Fraction of orfs with sites within 600 bp upstream = 0.0420816 Motif number 3 AAATATTGATAAAAAATAATAAACT 1 6 0 AAAAAATAAT 0.931997 -133 ATTTTTTATCAATATTTAATAAAAACTTAA 1 19 1 AATATTTAAT 0.724858 -120 ATATTTAATAAAAACTTAACTTGACAGTCC 1 30 1 AAAACTTAAC 0.974506 -109 AGTGAATTTTAAAACTTATTATAGGGACTG 1 54 0 AAAACTTATT 0.758148 -85 TCCCATAGTTAGAAAGTATTTATTAGATAT 1 111 0 AGAAAGTATT 0.810381 -28 ********** Masking position 4 Map Score: 1.67859 Number of sites scoring better than the average of aligned sites = 907 Number in coding regions = 652 Number in noncoding regions = 255 Number of orfs with sites within 600 bp upstream = 247 Fraction of orfs with sites within 600 bp upstream = 0.0396723 Motif number 4 TATAGGGACTGTCAAGTTAAGTTTTTATTA 1 35 0 GTCAAGTTAA 0.97841 -104 TTAGAGTTAGAACAAGTGAATTTTAAAACT 1 68 0 AACAAGTGAA 0.989543 -71 TATTTATTAGATATAGTGAATATTATATTA 1 95 0 ATATAGTGAA 0.97478 -44 ********** Masking position 5 Map Score: 0.0876568 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 22 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0