AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00272_pyro_reg_100.orf -o00272_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH0636 128 476aa long hypothetical cysteinyl-tRNA synthetase #2 PH0770 167 154aa long hypothetical protein #3 PH0771 46 391aa long hypothetical aspartate aminotransferase #4 PH1308 38 386aa long hypothetical serine aminotransferase #5 PH1371 191 389aa long hypothetical aspartate aminotransferase Motif number 1 TCATCACCAAAAAGAATTTACCTTCTTTAGG 1 14 1 AAAAATTTAC 0.768019 -115 TTACCTTCTTTAGGTATTTAAAGCTTGCTTT 1 31 1 TAGTATTTAA 0.952383 -98 TTTAAGCCAAAAAATATTTAACTAGATAAAC 2 54 0 AAATATTTAA 0.965152 -114 AATATCACAAAAATAATTTAAGCCAAAAAAT 2 70 0 AAAAATTTAA 0.884982 -98 ATAAATTTAAAAGTTTTTTAAGTTCATAATA 2 97 0 AAGTTTTTAA 0.977862 -71 AAAAAACTTTTAAATTTATACCGGTCAAAAT 2 109 1 TAATTTATAC 0.786481 -59 TGTGTTGCTAAAAATTTTTAAATTTTGACCG 2 130 0 AAATTTTTAA 0.965152 -38 AAAGTTTTATAAATTTTTCATG 3 2 1 AAGTTTATAA 0.967919 -45 TATACTTCCATAGGTATATAATTGTGG 4 22 1 TAGTATATAA 0.931794 -17 TAAGTTTGTCAAGCTTTATAAAGGTTATCTG 5 50 1 AAGTTTATAA 0.967919 -142 *** ******* Masking position 7 Map Score: 11.4678 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 183 Number in noncoding regions = 146 Number of orfs with sites within 600 bp upstream = 180 Fraction of orfs with sites within 600 bp upstream = 0.028911 Motif number 2 ACCTCAAGCCAAAAGCAAGCTTTAAATACCT 1 42 0 AAAGCAAGCT 0.907059 -87 GCAACTATGAAACCTCAAGCCAAAAGCAAGC 1 53 0 AACTCAAGCC 0.993101 -76 TAGTTGCCAAAACCGACATCCTAATAAAATT 1 77 1 AACGACATCC 0.930538 -52 TCACCTCCTTAATCTCCATCCAGGAATTTTA 1 101 0 AACTCCATCC 0.987687 -28 TTAACTAGATAAACTCAAGCCTTAGAATAGG 2 37 0 AACTCAAGCC 0.993101 -131 ACTCCAATTCAATCCTAATCTTTCGATAGTT 5 83 0 AACCTAATCT 0.906007 -109 ATCGAGTTTAAAACCCAATCTGTCCTCGATA 5 144 0 AACCCAATCT 0.984204 -48 ** ******** Masking position 8 Map Score: 5.59003 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 198 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 TCTTCATCACCAAAAAGAATTTAC 1 4 1 TCATCACCAA 0.947154 -125 TCACCCTTCACCTCCTTAATCTCCATCC 1 111 0 TCACCTCCTA 0.996731 -18 TTCTCCCCCTCACCAATTGTGT 2 156 0 TCTCCCCCTA 0.987441 -12 GTCACCTCCTCAATCGAGGACA 5 2 1 TCACCTCCTA 0.996731 -190 CTTCAATCACCACTTGAGAATATGATA 5 175 0 TCACCACTTA 0.982495 -17 ********* * Masking position 1 Map Score: 5.57881 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 81 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 GGATGGAGATTAAGGAGGTGAAGGGTGA 1 111 1 TAAGGAGGTG 0.982621 -18 ACACAATTGGTGAGGGGGAGAA 2 156 1 TGAGGGGGAG 0.992468 -12 TGTCCTCGATTGAGGAGGTGAC 5 3 0 TGAGGAGGTG 0.995568 -189 AGATTAGGATTGAATTGGAGTGATATCTTT 5 93 1 TGAATTGGAG 0.930232 -99 TATCATATTCTCAAGTGGTGATTGAAG 5 175 1 TCAAGTGGTG 0.973817 -17 ********** Masking position 3 Map Score: 3.88247 Number of sites scoring better than the average of aligned sites = 190 Number in coding regions = 159 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 5 GGATGTCGGTTTTGGCAACTATGAAACCTCAA 1 66 0 TTTGCACTAT 0.983446 -63 ATTTTTAAATTTTGACCGGTATAAATTTAAAA 2 116 0 TTTGCCGTAT 0.965678 -52 TATGTCCCACTTTGTCCTCGATTGAGGAGGTG 5 13 0 TTTGCCCGAT 0.993288 -179 ATAAAGGTTATCTGGGAACTATCGAAAGATTA 5 67 1 TCTGGACTAT 0.919059 -125 CTTTTACTTGTTTGTAAAATATTCGTATCGAG 5 119 1 TTTGAAATAT 0.756443 -73 TAAAACCCAATCTGTCCTCGATACGAATATTT 5 135 0 TCTGCCCGAT 0.990071 -57 CAGATTGGGTTTTAAACTCGATTATCATATTC 5 153 1 TTTAACCGAT 0.866574 -39 **** ** **** Masking position 11 Map Score: 2.79102 Number of sites scoring better than the average of aligned sites = 123 Number in coding regions = 109 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 6 AAACCGACATCCTAATAAAATTCCTGGATGG 1 86 1 CCAATAAAAT 0.93722 -43 AAATATTTAACTAGATAAACTCAAGCCTTAG 2 43 0 CTGATAAACT 0.982055 -125 ATATTATGAACTTAAAAAACTTTTAAATTTA 2 96 1 CTAAAAAACT 0.819413 -72 TAAATTTATACCGGTCAAAATTTAAAAATTT 2 119 1 CCGTCAAAAT 0.904021 -49 ACACCCAGAACCGGATTACATGAAAAATTTA 3 20 0 CCGATTACAT 0.884328 -27 CTTTATAAAGCTTGACAAACTTATAGCCTAT 5 42 0 CTGACAAACT 0.978434 -150 TCGATAGTTCCCAGATAACCTTTATAAAGCT 5 61 0 CCGATAACCT 0.987023 -131 ** ******** Masking position 8 Map Score: 2.79369 Number of sites scoring better than the average of aligned sites = 188 Number in coding regions = 171 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 7 AGGTTTCATAGTTGCCAAAACCGACATCCT 1 69 1 GTTGCCAAAA 0.972418 -60 CACCAATTGTGTTGCTAAAAATTTTTAAAT 2 138 0 GTTGCTAAAA 0.970463 -30 CCGGTTCTGGGTGTTCAAAA 3 37 1 GTGTTCAAAA 0.958067 -10 TCTTTTACTTGTTTGTAAAATATTCGTATC 5 118 1 GTTTGTAAAA 0.937358 -74 TATGATAATCGAGTTTAAAACCCAATCTGT 5 152 0 GAGTTTAAAA 0.865999 -40 ********** Masking position 7 Map Score: 0.46871 Number of sites scoring better than the average of aligned sites = 90 Number in coding regions = 76 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 8 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0