AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00360_pyro_reg_100.orf -o00360_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH0677 225 350aa long hypothetical acyl carrier protein synthetase #2 PH0770 167 154aa long hypothetical protein #3 PH0771 46 391aa long hypothetical aspartate aminotransferase #4 PH1014 60 181aa long hypothetical 3-octaprenyl-4-hydroxybenzoate carboxy-lyase #5 PH1308 38 386aa long hypothetical serine aminotransferase #6 PH1371 191 389aa long hypothetical aspartate aminotransferase Motif number 1 TCAATCTAGAGTTTTTAAGTTAGATTTATGT 1 47 1 GTTTTAAGTT 0.88012 -179 TTAAGTTAGATTTATGTAGTTTTCGGTGGAG 1 61 1 TTTATTAGTT 0.974991 -165 GATCGCCGAATATATGTAGGTAATGATAGCA 1 120 0 TATATTAGGT 0.756246 -106 CCGAAAGTCTTTTATAAAGGGTTGAAAGGCT 1 174 1 TTTATAAGGG 0.88635 -52 AAGGCTTGAGTTTATCTAGTTAAATATTTTT 2 45 1 TTTATTAGTT 0.974991 -123 AATTTAAAAGTTTTTTAAGTTCATAATATCA 2 94 0 TTTTTAAGTT 0.974991 -74 TTGCTAAAAATTTTTAAATTTTGACCGGTAT 2 126 0 TTTTTAATTT 0.870791 -42 AAAGTTTTATAAATTTTTCATGTAAT 3 6 1 TTTATAATTT 0.919552 -41 CTTCTCAATGTTTATAAAGTTGCAATTTAAG 4 18 0 TTTATAAGTT 0.985102 -43 CCTATTGTTTTTATACTTCCATAGGTAT 5 8 1 TTTTTTACTT 0.769576 -31 TTTGTCAAGCTTTATAAAGGTTATCTGGGAA 6 54 1 TTTATAAGGT 0.976422 -138 ***** ***** Masking position 8 Map Score: 15.0353 Number of sites scoring better than the average of aligned sites = 217 Number in coding regions = 173 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 2 CTGAGTTCAATCTAGAGTTTTTAAGTTAGATTT 1 41 1 TCTATTTTTA 0.790147 -185 TATTCGGCGATCAACGATTTTAGATTGTACTAT 1 139 1 TCAATTTTAG 0.957325 -87 TATTAGCCTTTCAACCCTTTATAAAAGACTTTC 1 176 0 TCAATTTATA 0.809132 -50 CTAGATAAACTCAAGCCTTAGAATAGGGAATTC 2 31 0 TCAATTAGAA 0.814959 -137 TTTATCTAGTTAAATATTTTTTGGCTTAAATTA 2 55 1 TAAATTTTTG 0.896924 -113 TTTTTTGGCTTAAATTATTTTTGTGATATTATG 2 71 1 TAAATTTTTG 0.908148 -97 GGTATAAATTTAAAAGTTTTTTAAGTTCATAAT 2 98 0 TAAATTTTTA 0.725161 -70 ATTGTGTTGCTAAAAATTTTTAAATTTTGACCG 2 130 0 TAAATTTTAA 0.646581 -38 CGGATTACATGAAAAATTTATAAAACTTT 3 7 0 GAAATTATAA 0.675841 -40 GTAAACCTTCTCAATGTTTATAAAGTTGCAATT 4 22 0 TCAATTATAA 0.954788 -39 TATAAGTTTGTCAAGCTTTATAAAGGTTATCTG 6 48 1 TCAATTATAA 0.954788 -144 **** ****** Masking position 4 Map Score: 8.43727 Number of sites scoring better than the average of aligned sites = 256 Number in coding regions = 199 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 3 TTTTCTTTTCTTCACCTATTAGCCTTTCAA 1 195 0 TTCACCTATT 0.943027 -31 TCTTCATCACCTTTTCTTTTCTTCA 1 211 0 ATCACCTTTT 0.898695 -15 TTCTCCCCCTCACCAATTGTGTTGCTAA 2 150 0 CTCACCAATT 0.991916 -18 TCTCCCACCAATTTCAGTAAACC 4 48 0 CCCACCAATT 0.98223 -13 TAAAAGATATCACTCCAATTCAATCCTAAT 6 95 0 CACTCCAATT 0.901966 -97 CTTCAATCACCACTTGAGAATATGA 6 177 0 ATCACCACTT 0.960833 -15 ********** Masking position 9 Map Score: 4.19981 Number of sites scoring better than the average of aligned sites = 88 Number in coding regions = 78 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 TGAAAGCTTAAGGGGGCAAAAAAG 1 5 0 AGGGGGCAAA 0.91906 -221 GTCTTTTATAAAGGGTTGAAAGGCTAATAG 1 180 1 AAGGGTTGAA 0.910379 -46 AAAGGCTAATAGGTGAAGAAAAGAAAAGGT 1 198 1 AGGTGAAGAA 0.95723 -28 AGAAAAGAAAAGGTGATGAAGA 1 214 1 AGGTGATGAA 0.976613 -12 ACAATTGGTGAGGGGGAGAA 2 158 1 AGGGGGAGAA 0.99049 -10 TCCTCGATTGAGGAGGTGAC 6 1 0 AGGAGGTGAC 0.947045 -191 TCATATTCTCAAGTGGTGATTGAAG 6 177 1 AAGTGGTGAT 0.89267 -15 ********** Masking position 9 Map Score: 4.00508 Number of sites scoring better than the average of aligned sites = 417 Number in coding regions = 357 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 5 CTTTTTTGCCCCCTTAAGCTTTCAATTAA 1 9 1 CCCCCTAAGC 0.995364 -217 TTCTTTTCTTCACCTATTAGCCTTTCAACCC 1 192 0 CACCTTTAGC 0.911938 -34 CCCTACAACACCCTTCAGCGGAATTCCCT 2 9 1 CACCCTCAGC 0.993262 -159 TTCTCCCCCTCACCAATTGTGTTG 2 154 0 TCCCCTCACC 0.972868 -14 TTTTGAACACCCAGAACCGGATTACATG 3 29 0 CACCCGAACC 0.980364 -18 TTCGATAGTTCCCAGATAACCTTTATAAAGC 6 62 0 CCCAGTAACC 0.904157 -130 ***** ***** Masking position 9 Map Score: 1.70933 Number of sites scoring better than the average of aligned sites = 159 Number in coding regions = 142 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 6 TGTCCCACTTTGTCCTCGATTGAGGAGGTG 6 13 0 TGTCCTCGAT 0.995212 -179 AAACCCAATCTGTCCTCGATACGAATATTT 6 135 0 TGTCCTCGAT 0.995212 -57 GATTGGGTTTTAAACTCGATTATCATATTC 6 155 1 TAAACTCGAT 0.94063 -37 ********** Masking position 9 Map Score: 0.64375 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0