AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00360_pyro_reg_300.orf -o00360_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH0677 225 350aa long hypothetical acyl carrier protein synthetase #2 PH0770 167 154aa long hypothetical protein #3 PH0771 46 391aa long hypothetical aspartate aminotransferase #4 PH1014 60 181aa long hypothetical 3-octaprenyl-4-hydroxybenzoate carboxy-lyase #5 PH1308 38 386aa long hypothetical serine aminotransferase #6 PH1371 191 389aa long hypothetical aspartate aminotransferase Motif number 1 TCAATCTAGAGTTTTTAAGTTAGATTTATGT 1 47 1 GTTTTAAGTT 0.907113 -179 TTAAGTTAGATTTATGTAGTTTTCGGTGGAG 1 61 1 TTTATTAGTT 0.973702 -165 GATCGCCGAATATATGTAGGTAATGATAGCA 1 120 0 TATATTAGGT 0.705669 -106 CCGAAAGTCTTTTATAAAGGGTTGAAAGGCT 1 174 1 TTTATAAGGG 0.872633 -52 AAGGCTTGAGTTTATCTAGTTAAATATTTTT 2 45 1 TTTATTAGTT 0.973702 -123 AATTTAAAAGTTTTTTAAGTTCATAATATCA 2 94 0 TTTTTAAGTT 0.981081 -74 ACTTAAAAAACTTTTAAATTTATACCGGTCA 2 105 1 CTTTTAATTT 0.707519 -63 TTGCTAAAAATTTTTAAATTTTGACCGGTAT 2 126 0 TTTTTAATTT 0.927773 -42 AAAGTTTTATAAATTTTTCATGTAAT 3 6 1 TTTATAATTT 0.946477 -41 CTTCTCAATGTTTATAAAGTTGCAATTTAAG 4 18 0 TTTATAAGTT 0.986186 -43 CCTATTGTTTTTATACTTCCATAGGTAT 5 8 1 TTTTTTACTT 0.796249 -31 TTTGTCAAGCTTTATAAAGGTTATCTGGGAA 6 54 1 TTTATAAGGT 0.975556 -138 ***** ***** Masking position 8 Map Score: 14.9104 Number of sites scoring better than the average of aligned sites = 238 Number in coding regions = 190 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 2 CTGAGTTCAATCTAGAGTTTTTAAGTTAGATTT 1 41 1 TCTATTTTTA 0.809955 -185 TATTCGGCGATCAACGATTTTAGATTGTACTAT 1 139 1 TCAATTTTAG 0.962269 -87 TATTAGCCTTTCAACCCTTTATAAAAGACTTTC 1 176 0 TCAATTTATA 0.828146 -50 CTAGATAAACTCAAGCCTTAGAATAGGGAATTC 2 31 0 TCAATTAGAA 0.833528 -137 TTTATCTAGTTAAATATTTTTTGGCTTAAATTA 2 55 1 TAAATTTTTG 0.905366 -113 TTTTTTGGCTTAAATTATTTTTGTGATATTATG 2 71 1 TAAATTTTTG 0.918221 -97 GGTATAAATTTAAAAGTTTTTTAAGTTCATAAT 2 98 0 TAAATTTTTA 0.715234 -70 ATTGTGTTGCTAAAAATTTTTAAATTTTGACCG 2 130 0 TAAATTTTAA 0.636646 -38 CGGATTACATGAAAAATTTATAAAACTTT 3 7 0 GAAATTATAA 0.703141 -40 GTAAACCTTCTCAATGTTTATAAAGTTGCAATT 4 22 0 TCAATTATAA 0.960013 -39 TATAAGTTTGTCAAGCTTTATAAAGGTTATCTG 6 48 1 TCAATTATAA 0.960013 -144 **** ****** Masking position 4 Map Score: 8.43727 Number of sites scoring better than the average of aligned sites = 256 Number in coding regions = 199 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 3 TTGAAAGGCTAATAGGTGAAGAAAAGAAAA 1 195 1 AATAGGTGAA 0.949512 -31 TGAAGAAAAGAAAAGGTGATGAAGA 1 211 1 AAAAGGTGAT 0.909744 -15 TTAGCAACACAATTGGTGAGGGGGAGAA 2 150 1 AATTGGTGAG 0.992878 -18 GGTTTACTGAAATTGGTGGGAGA 4 48 1 AATTGGTGGG 0.984327 -13 ATTAGGATTGAATTGGAGTGATATCTTTTA 6 95 1 AATTGGAGTG 0.912693 -97 TCATATTCTCAAGTGGTGATTGAAG 6 177 1 AAGTGGTGAT 0.965366 -15 ********** Masking position 2 Map Score: 4.19981 Number of sites scoring better than the average of aligned sites = 88 Number in coding regions = 78 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 CTTTTTTGCCCCCTTAAGCTTTCA 1 5 1 TTTGCCCCCT 0.914815 -221 CTATTAGCCTTTCAACCCTTTATAAAAGAC 1 180 0 TTCAACCCTT 0.905727 -46 ACCTTTTCTTTTCTTCACCTATTAGCCTTT 1 198 0 TTCTTCACCT 0.95489 -28 TCTTCATCACCTTTTCTTTTCT 1 214 0 TTCATCACCT 0.975306 -12 TTCTCCCCCTCACCAATTGT 2 158 0 TTCTCCCCCT 0.98995 -10 GTCACCTCCTCAATCGAGGA 6 1 1 GTCACCTCCT 0.944179 -191 CTTCAATCACCACTTGAGAATATGA 6 177 0 ATCACCACTT 0.887212 -15 ********** Masking position 2 Map Score: 4.00508 Number of sites scoring better than the average of aligned sites = 417 Number in coding regions = 357 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 5 TTAATTGAAAGCTTAAGGGGGCAAAAAAG 1 9 0 GCTTAGGGGG 0.995883 -217 GGGTTGAAAGGCTAATAGGTGAAGAAAAGAA 1 192 1 GCTAAAGGTG 0.921059 -34 AGGGAATTCCGCTGAAGGGTGTTGTAGGG 2 9 0 GCTGAGGGTG 0.994015 -159 CAACACAATTGGTGAGGGGGAGAA 2 154 1 GGTGAGGGGA 0.975846 -14 CATGTAATCCGGTTCTGGGTGTTCAAAA 3 29 1 GGTTCGGGTG 0.982534 -18 GCTTTATAAAGGTTATCTGGGAACTATCGAA 6 62 1 GGTTACTGGG 0.914008 -130 ***** ***** Masking position 3 Map Score: 1.70933 Number of sites scoring better than the average of aligned sites = 159 Number in coding regions = 142 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 6 CACCTCCTCAATCGAGGACAAAGTGGGACA 6 13 1 ATCGAGGACA 0.994529 -179 AAATATTCGTATCGAGGACAGATTGGGTTT 6 135 1 ATCGAGGACA 0.994529 -57 GAATATGATAATCGAGTTTAAAACCCAATC 6 155 0 ATCGAGTTTA 0.932691 -37 ********** Masking position 5 Map Score: 0.64375 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0