AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00472_pyro_reg_300.orf -o00472_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH1830 100 334aa long hypothetical glyceraldehyde-3-phosphate dehydrogenase Motif number 1 CTTCCCCCCACCGCCCTTACCT 1 2 1 TTCCCCCACC 0.997319 -99 TTTAAAAATTATCCCGACAAAATAGTTAAGA 1 46 1 ATCCCACAAA 0.996322 -55 TAGTTAAGAGATACCTCCAAAAAAGATAGAA 1 68 1 ATACCCCAAA 0.996338 -33 GTTCCCACCGAATTCTATCTTT 1 89 0 TTCCCCCGAA 0.994932 -12 ***** ***** Masking position 2 Map Score: 5.79137 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 74 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 TTTTTAAAAGCCCAGGAAGATAGGTAAGGGCGG 1 21 0 CCCAAGATAG 0.999465 -80 TAAAAATTATCCCGACAAAATAGTTAAGAGATA 1 48 1 CCCAAAATAG 0.998588 -53 AGAGATACCTCCAAAAAAGATAGAATTCGGTGG 1 74 1 CCAAAGATAG 0.998328 -27 *** ******* Masking position 7 Map Score: 3.91276 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 11 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 CCCCCCACCGCCCTTACCTATCTTCCTGGG 1 14 1 CCCTTACCTA 0.984607 -87 TCTTCCTGGGCTTTTAAAAATTATCCCGAC 1 34 1 CTTTTAAAAA 0.888444 -67 TTGGAGGTATCTCTTAACTATTTTGTCGGG 1 58 0 CTCTTAACTA 0.994359 -43 TAAGAGATACCTCCAAAAAAGATAGAATTC 1 72 1 CTCCAAAAAA 0.96532 -29 ********** Masking position 6 Map Score: 2.00366 Number of sites scoring better than the average of aligned sites = 284 Number in coding regions = 251 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 AGATAGGTAAGGGCGGTGGGGGGAAG 1 7 0 GGGCGGTGGG 0.99767 -94 TCTCTTAACTATTTTGTCGGGATAATTTTT 1 49 0 ATTTTGTCGG 0.981371 -52 AAAAGATAGAATTCGGTGGGAAC 1 88 1 ATTCGGTGGG 0.998616 -13 ********** Masking position 7 Map Score: 1.26747 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 43 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0