AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00561_pyro_reg_100.orf -o00561_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH1884 27 231aa long hypothetical triosephosphate isomerase #2 PH1886 206 272aa long hypothetical L-isoaspartyl protein carboxyl methyltransferase Motif number 1 ACACGATAGAGTGGCCGGGGTGGTGTAGCC 2 71 1 GTGGCCGGGG 0.999481 -136 CCGGGGTGGTGTAGCCTGGTTAGCACAGGG 2 85 1 GTAGCCTGGT 0.976304 -122 GGGATCCACAGTCCCCTGTGCTAACCAGGC 2 98 0 GTCCCCTGTG 0.976702 -109 ATTTGAACCCGGGCCAGGGGATCCACAGTC 2 115 0 GGGCCAGGGG 0.996355 -92 GTCTGTTTCTGGGGCCGGGGCCGGGATTTG 2 140 0 GGGGCCGGGG 0.999519 -67 ********** Masking position 5 Map Score: 9.39321 Number of sites scoring better than the average of aligned sites = 82 Number in coding regions = 69 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 AGTTTTCGCCAAAATCGAGAGAAGAAGGAG 2 20 0 AAAATCGAGA 0.991715 -187 CCAGGAGCACACGATAGAGTGGCCGGGGTG 2 63 1 ACGATAGAGT 0.963948 -144 GACTTTTCTGAAAATAAAGATTTAACAAAG 2 167 1 AAAATAAAGA 0.95116 -40 GCTTCTTCAAGCAATCGAGAC 2 196 1 GCAATCGAGA 0.990874 -11 ********** Masking position 5 Map Score: 1.09525 Number of sites scoring better than the average of aligned sites = 139 Number in coding regions = 128 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 ATCGTGTGCTCCTGGATTAGATTTATAAAGT 2 47 0 CCGGATTAGA 0.986537 -160 GGGATTTGAACCCGGGCCAGGGGATCCACAG 2 117 0 CCGGGCCAGG 0.604344 -90 GGGGCCGGGGCCGGGATTTGAACCCGGGCCA 2 129 0 CCGGATTTGA 0.989838 -78 GGCCCCGGCCCCAGAAACAGACTTTTCTGAA 2 148 1 CCGAAACAGA 0.960493 -59 ** ******** Masking position 4 Map Score: 0.949159 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 73 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0