AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00561_pyro_reg_300.orf -o00561_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH1884 27 231aa long hypothetical triosephosphate isomerase #2 PH1886 206 272aa long hypothetical L-isoaspartyl protein carboxyl methyltransferase Motif number 1 CTTTATAAATCTAATCCAGGAGCACACGATAGAG 2 48 1 CATCCAGGCA 0.98525 -159 CCAGGCTACACCACCCCGGCCACTCTATCGTGTG 2 70 0 CACCCGGCCT 0.998019 -137 GTCCCCTGTGCTAACCAGGCTACACCACCCCGGC 2 84 0 CACCAGGCCA 0.998009 -123 TGTGGATCCCCTGGCCCGGGTTCAAATCCCGGCC 2 118 1 CGCCCGGGCA 0.869324 -89 GTTCAAATCCCGGCCCCGGCCCCAGAAACAGACT 2 137 1 CGCCCGGCCA 0.839621 -70 * * ****** ** Masking position 6 Map Score: 9.39774 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 12 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 AGGAGCACACGATAGAGTGGCCGGGGTGGTGT 2 65 1 GTGAGTGGCC 0.996354 -142 GAGTGGCCGGGGTGGTGTAGCCTGGTTAGCAC 2 79 1 GTGTGTAGCC 0.997696 -128 TAGCACAGGGGACTGTGGATCCCCTGGCCCGG 2 105 1 GCGTGGATCC 0.989895 -102 AGAAAAGTCTGTTTCTGGGGCCGGGGCCGGGA 2 144 0 GTCTGGGGCC 0.995774 -63 * * ******** Masking position 7 Map Score: 2.04339 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 40 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 AGTTTTCGCCAAAATCGAGAGAAGAAGGAG 2 20 0 AAAATCGAGA 0.908376 -187 TAATCCAGGAGCACACGATAGAGTGGCCGG 2 59 1 GCACACGATA 0.980441 -148 AGCCTGGTTAGCACAGGGGACTGTGGATCC 2 97 1 GCACAGGGGA 0.986632 -110 GCCGGGATTTGAACCCGGGCCAGGGGATCC 2 121 0 GAACCCGGGC 0.97486 -86 GCTTCTTCAAGCAATCGAGAC 2 196 1 GCAATCGAGA 0.991488 -11 ********** Masking position 3 Map Score: 1.4835 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 163 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 GATTTTGGCGAAAACTTTATAAATCTAATC 2 34 1 AAAACTTTAT 0.963465 -173 ATTTTCAGAAAAGTCTGTTTCTGGGGCCGG 2 152 0 AAGTCTGTTT 0.951677 -55 AAGCTTTGTTAAATCTTTATTTTCAGAAAA 2 170 0 AAATCTTTAT 0.982601 -37 AAGATTTAACAAAGCTTCTTCAAGCAATCG 2 183 1 AAAGCTTCTT 0.961022 -24 ********** Masking position 6 Map Score: 0.405541 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 55 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0