AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00562_mthe_reg_100.orf -o00562_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MTH874 113 porphobilinogen deaminase #2 MTH1639 163 cell division control protein Cdc48 Motif number 1 TTTTCAAAAACTCCAGTTTATTAAAAATCA 1 35 0 CTCCAGTTTA 0.972655 -79 TGAATCATCTCCAGTAAACGTTAATCAT 1 96 0 CTCCAGTAAA 0.991049 -18 CTCTGTTTAATACCACATCG 2 1 1 CTCTGTTTAA 0.913321 -163 TATATAAATGTTTCGGTAAAGTTTATATAC 2 49 0 TTTCGGTAAA 0.960832 -115 AACCGGAATATTCTAGTAAATTTAGGTTAC 2 102 0 TTCTAGTAAA 0.961538 -62 TACTAGAATATTCCGGTTAAATTAAATATC 2 114 1 TTCCGGTTAA 0.99596 -50 ATTATTATGATTCCGGTTGATATTTAATTT 2 132 0 TTCCGGTTGA 0.989031 -32 ********** Masking position 10 Map Score: 11.0881 Number of sites scoring better than the average of aligned sites = 230 Number in coding regions = 181 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 2 AAACCGGTGGTAGCCATAATTATGTGATTT 1 11 1 TAGCCATAAT 0.848384 -103 GATTTTTAATAAACTGGAGTTTTTGAAAAG 1 36 1 AAACTGGAGT 0.949686 -78 TGATTAACGTTTACTGGAGATGATTCA 1 97 1 TTACTGGAGA 0.922525 -17 TAAATTTAGGTTACTATAATACATGTACAG 2 86 0 TTACTATAAT 0.920312 -78 TAACCTAAATTTACTAGAATATTCCGGTTA 2 103 1 TTACTAGAAT 0.972578 -61 ATATTTAATTTAACCGGAATATTCTAGTAA 2 113 0 TAACCGGAAT 0.992137 -51 AATTAAATATCAACCGGAATCATAATAATA 2 133 1 CAACCGGAAT 0.980372 -31 ********** Masking position 8 Map Score: 5.3287 Number of sites scoring better than the average of aligned sites = 320 Number in coding regions = 274 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 3 AGTTTATTAAAAATCACATAATTATGGCTA 1 21 0 AAATCACATA 0.909016 -93 AAAAGTTATATAATAGGATACAATAAATTT 1 61 1 TAATAGGATA 0.918747 -53 CAGTAAACGTTAATCATTTGAGAAATTTAT 1 83 0 TAATCATTTG 0.89008 -31 AAAATCCATCTAATAGTATATAAACTTTAC 2 34 1 TAATAGTATA 0.961545 -130 CATGTACAGGTAATCATATATAAATGTTTC 2 65 0 TAATCATATA 0.988857 -99 ATCATAATAATAATCATAAAGAG 2 151 1 TAATCATAAA 0.956853 -13 ********** Masking position 4 Map Score: 3.61418 Number of sites scoring better than the average of aligned sites = 97 Number in coding regions = 54 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0