AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00920_mthe_reg_100.orf -o00920_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MTH1819 134 ferredoxin Motif number 1 AAAAATACCTGATGATGGATC 1 1 0 GTGATGGATC 0.995962 -134 AGAATGAGCCGCGGTTTGTTGCTAAAAATAC 1 24 0 GGGTTTGTTG 0.982357 -111 GGATGGAGCAGCTGATGGTTGTGAGGAGAAT 1 50 0 GTGATGGTTG 0.998951 -85 AAAAATAGTTGGTGATGGATGGAGCAGCTGA 1 66 0 GTGATGGATG 0.998948 -69 * ********* Masking position 6 Map Score: 6.76482 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 99 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 CGCGGTTTGTTGCTAAAAATACCTGATGAT 1 16 0 TGCTAAAAAT 0.993916 -119 CGGCTCATTCTCCTCACAACCATCAGCTGC 1 44 1 TCCTCACAAC 0.98863 -91 ATGGGGCTATTGCTAAAAATAGTTGGTGAT 1 81 0 TGCTAAAAAT 0.993916 -54 GATGTCACCCTAAAAACTGAAGTCCAA 1 118 0 CCCTAAAAAC 0.993299 -17 ********** Masking position 6 Map Score: 5.31682 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 33 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 TAGCAACAAACCGCGGCTCATTCTCCTCACAAC 1 31 1 CGGCTCATTC 0.994743 -104 TCACAACCATCAGCTGCTCCATCCATCACCAAC 1 57 1 CGGCTCCATC 0.99865 -78 CTATTTTTAGCAATAGCCCCATATTAATATTGG 1 89 1 CAGCCCCATA 0.994474 -46 ACCCTAAAAACTGAAGTCCAATATTAATATGGG 1 106 0 CGGTCCAATA 0.99176 -29 * * ******** Masking position 12 Map Score: 1.60382 Number of sites scoring better than the average of aligned sites = 130 Number in coding regions = 121 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 TTAGCAACAAACCGCGGCTCATTCTCCTCA 1 30 1 ACCGCGGCTC 0.998728 -105 CTCACAACCATCAGCTGCTCCATCCATCAC 1 56 1 TCAGCTGCTC 0.997252 -79 ********** Masking position 9 Map Score: 0.182209 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 4 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0