AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i012_Glycogen_Biosynthesis_aquae_reg_100.orf -o012_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01502 110 Aquifex_aeolicus Motif number 1 AAAACTGCTTACACAGGCGGCTTCTGTCCC 1 39 1 ACACAGGCGG 0.993514 -72 CGCGTATCTATGATACGGGGACAGAAGCCG 1 56 0 TGATACGGGG 0.994988 -55 CCCGTATCATAGATACGCGGTTTTAGCCCG 1 67 1 AGATACGCGG 0.999257 -44 ATTTTATAGTAAATCCGCGGGCTAAAACCG 1 84 0 AAATCCGCGG 0.996553 -27 ********** Masking position 3 Map Score: 6.43443 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 45 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 TCATTTTAAAAAACTGCTTACACAGGCGGC 1 30 1 AAACTGCTTA 0.980256 -81 ACGGGGACAGAAGCCGCCTGTGTAAGCAGT 1 42 0 AAGCCGCCTG 0.989775 -69 CCGCGGGCTAAAACCGCGTATCTATGATAC 1 70 0 AAACCGCGTA 0.99586 -41 ACGCGGTTTTAGCCCGCGGATTTACTATAA 1 81 1 AGCCCGCGGA 0.9936 -30 ********** Masking position 1 Map Score: 3.59632 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 84 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0