AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i012_Glycogen_Biosynthesis_aquae_reg_300.orf -o012_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01502 110 Aquifex_aeolicus Motif number 1 GGGACAGAAGCCGCCTGTGTAAGCAGTTTT 1 39 0 CCGCCTGTGT 0.993833 -72 CGGCTTCTGTCCCCGTATCATAGATACGCG 1 56 1 CCCCGTATCA 0.995258 -55 CGGGCTAAAACCGCGTATCTATGATACGGG 1 67 0 CCGCGTATCT 0.999297 -44 CGGTTTTAGCCCGCGGATTTACTATAAAAT 1 84 1 CCGCGGATTT 0.996739 -27 ********** Masking position 8 Map Score: 6.43443 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 45 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 GCCGCCTGTGTAAGCAGTTTTTTAAAATGA 1 30 0 TAAGCAGTTT 0.982207 -81 ACTGCTTACACAGGCGGCTTCTGTCCCCGT 1 42 1 CAGGCGGCTT 0.990085 -69 GTATCATAGATACGCGGTTTTAGCCCGCGG 1 70 1 TACGCGGTTT 0.995788 -41 TTATAGTAAATCCGCGGGCTAAAACCGCGT 1 81 0 TCCGCGGGCT 0.994236 -30 ********** Masking position 10 Map Score: 3.59632 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 84 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0