AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i020_TCA_aquae_reg_100.orf -o020_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01423 295 Aquifex_aeolicus #2 RAA01521 85 Aquifex_aeolicus Motif number 1 TCACAGAATTAGGAAAATACTTTTTGCTAC 1 28 1 AGGAAAATAC 0.982894 -268 TCAACTTAGGTGGTAAATTAAAAAGAGATG 1 135 1 TGGTAAATTA 0.885211 -161 CCCACGATTAAGGAAAAAACAAGGATAAGT 1 200 0 AGGAAAAAAC 0.922652 -96 CCTGTTTACAAGGTATATAATCGTGCCTCC 1 228 0 AGGTATATAA 0.9466 -68 CCTTGTAAACAGGCAAATAAAGAACAGCAG 1 245 1 AGGCAAATAA 0.994829 -51 CCTCCTTTTAAGGCAAATTATTAGTATATC 2 17 1 AGGCAAATTA 0.988193 -69 CTAAAATTAAAGGCAATTAAAACCCCTTTT 2 53 1 AGGCAATTAA 0.975575 -33 ********** Masking position 5 Map Score: 9.50724 Number of sites scoring better than the average of aligned sites = 145 Number in coding regions = 138 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 AGGTGGTAAATTAAAAAGAGATGAGTGAAG 1 142 1 TTAAAAAGAG 0.98821 -154 TGTAAATACAATAAAGAGAGCTTTGTCAAC 1 171 0 ATAAAGAGAG 0.951119 -125 ATAATTTGCCTTAAAAGGAGGAAGCGA 2 8 0 TTAAAAGGAG 0.992346 -78 AAGCTCCTCCTGAAAAGGGGTTTTAATTGC 2 65 0 TGAAAAGGGG 0.978074 -21 ********** Masking position 5 Map Score: 1.93941 Number of sites scoring better than the average of aligned sites = 133 Number in coding regions = 108 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 AAAATTGGGTTTATTCGTAGCAAAAAGTAT 1 44 0 TTATTCGTAG 0.987927 -252 AAGAAATTATTAATCCGTAGAGCATCAAAC 1 75 0 TAATCCGTAG 0.943655 -221 GTATTTACACTTATCCTTGTTTTTTCCTTA 1 192 1 TTATCCTTGT 0.865337 -104 TGTTTTTTCCTTAATCGTGGGAGGCACGAT 1 209 1 TTAATCGTGG 0.973248 -87 TTAAGGCAAATTATTAGTATATCAAAATGC 2 24 1 TTATTAGTAT 0.841227 -62 TTAATTGCCTTTAATTTTAGCATTTTGATA 2 43 0 TTAATTTTAG 0.739365 -43 ********** Masking position 3 Map Score: 0.907549 Number of sites scoring better than the average of aligned sites = 188 Number in coding regions = 175 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0