AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i057_Chorismate_Biosynthes_aquae_reg_100.orf -o057_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00972 117 Aquifex_aeolicus #2 RAA00975 61 Aquifex_aeolicus #3 RAA00976 45 Aquifex_aeolicus #4 RAA01778 44 Aquifex_aeolicus #5 RAA00143 186 Aquifex_aeolicus #6 RAA00504 37 Aquifex_aeolicus #7 RAA01074 161 Aquifex_aeolicus Motif number 1 GGACAAATCTCAGAGGGACGGATATAAACCTA 1 41 1 CGAGGGCGGA 0.99458 -77 AATAGCCATACTCAGGTACGCCCACATATTCT 1 80 1 CCAGGTCGCC 0.985504 -38 GGCTCCGGACCCCGGGGTCGCGGGTTCAAGTC 5 40 0 CCGGGGCGCG 0.751635 -147 GGACAGAGCACGGGGCTCCGGACCCCGGGGTC 5 53 0 CGGGCTCGGA 0.941281 -134 CTCTGTCCACCTGAGCTACGGGCACTATTATA 5 77 1 CGAGCTCGGG 0.996167 -110 GTATCGGGGCGGCCGGACTTGAACCG 7 5 1 CGGGCGCCGG 0.643027 -157 GCTTTGGGAGCCGAAGGTCGCCGGTTCAAGTC 7 26 0 CGAAGGCGCC 0.977236 -136 GCTCAGGTGGTAGAGCGTCGGCTTTGGGAGCC 7 46 0 TGAGCGCGGC 0.985051 -116 GCTCTACCACCTGAGCTACGCCCCGTCCCGAA 7 62 1 CGAGCTCGCC 0.996396 -100 * ***** **** Masking position 9 Map Score: 14.745 Number of sites scoring better than the average of aligned sites = 142 Number in coding regions = 119 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 TTATATCCGTCCCTCTGAGATTTGTCCTTA 1 38 0 CCCTCTGAGA 0.973066 -80 TCTTCTACCTCCGAGAGAACTTTATT 4 29 0 ACCTCCGAGA 0.982028 -16 GGGTTCAAGTCCCGCCGGGCACACTTATCA 5 21 0 CCCGCCGGGC 0.971125 -166 CGGGGTCCGGAGCCCCGTGCTCTGTCCACC 5 58 1 AGCCCCGTGC 0.984037 -129 CGTGCTCTGTCCACCTGAGCTACGGGCACT 5 73 1 CCACCTGAGC 0.951377 -114 TTTAGCACCTCCTTGATAGTTTATTA 5 171 0 ACCTCCTTGA 0.79487 -16 CAAGTCCGGCCGCCCCGATAC 7 2 0 CGCCCCGATA 0.95648 -160 CGACGCTCTACCACCTGAGCTACGCCCCGT 7 58 1 CCACCTGAGC 0.951377 -104 ACCTGAGCTACGCCCCGTCCCGAATAAAAT 7 70 1 CGCCCCGTCC 0.959856 -92 CATTTTCTTCACCTCCGTTATAATATTTTA 7 94 0 ACCTCCGTTA 0.897263 -68 ********** Masking position 5 Map Score: 10.2508 Number of sites scoring better than the average of aligned sites = 500 Number in coding regions = 443 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 AGAAGAAATCCTCAAGAAAATT 2 1 1 AGAAGAATCT 0.956699 -61 AGAAAATTGAAGAAGAAATTATGCAGGCTGCA 2 25 1 AGAAGAATTT 0.979721 -37 GTTAAAAGATTTTAATATAATAA 4 2 1 TTAAAAATTT 0.930504 -43 AGAAAAGATTTTACTCTTTCTC 6 26 0 AGAAAAATTT 0.986086 -12 CCCGTCCCGAATAAAATATTATAACGGAGGTG 7 83 1 ATAAAAATTT 0.889575 -79 GTGAAGAAAATGAAAAAATTATTACTACTTCT 7 112 1 TGAAAAATTT 0.975186 -50 ****** *** * Masking position 6 Map Score: 4.85885 Number of sites scoring better than the average of aligned sites = 55 Number in coding regions = 49 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 TGATTGATTAGGTTTATATCCGTCCCTCTGA 1 50 0 GGTTTAATCC 0.962187 -68 CGGGGTCGCGGGTTCAAGTCCCGCCGGGCAC 5 29 0 GGTTCAGTCC 0.995033 -158 CAGAGCACGGGGCTCCGGACCCCGGGGTCGC 5 51 0 GGCTCCGACC 0.9458 -136 AAATTACTTTGATTTCAGTCATAACGTAAAC 5 112 1 GATTTCGTCA 0.884564 -75 TCATTTGCAAGGTTTACGTTATGACTGAAAT 5 123 0 GGTTTAGTTA 0.902377 -64 GAAGGTCGCCGGTTCAAGTCCGGCCGCCCCG 7 15 0 GGTTCAGTCC 0.995033 -147 ****** **** Masking position 4 Map Score: 2.94245 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 148 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 TCTTGCCTTTAGGGGAGAATATGTGGGCGT 1 97 0 AGGGGAGAAT 0.715137 -21 TCCTCAAGAAAATTGAAGAAGAAATTATGC 2 19 1 AATTGAAGAA 0.52745 -43 TGACGGTTATAAGGGAAAAACAGTTGAGAG 3 16 1 AAGGGAAAAA 0.810134 -30 AACAGTTGAGAGGTGAAGGGTA 3 34 1 AGGTGAAGGG 0.961635 -12 ACACTTATCAAGGTGCTGAG 5 1 0 AGGTGCTGAG 0.953654 -186 CCCGTAGCTCAGGTGGACAGAGCACGGGGC 5 69 0 AGGTGGACAG 0.903615 -118 ACTATCAAGGAGGTGCTAAA 5 177 1 AGGTGCTAAA 0.925453 -10 GGCGTAGCTCAGGTGGTAGAGCGTCGGCTT 7 54 0 AGGTGGTAGA 0.84222 -108 ATTATAACGGAGGTGAAGAAAATGAAAAAA 7 100 1 AGGTGAAGAA 0.978392 -62 CTGAAGTGAGAAGGCAAAGCTTG 7 149 0 AAGTGAGAAG 0.8958 -13 ********** Masking position 1 Map Score: 2.80841 Number of sites scoring better than the average of aligned sites = 1335 Number in coding regions = 1234 Number in noncoding regions = 101 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 6 AAGATTTTAATATAATAAAGTTCTCTCGGA 4 16 1 TATAATAAAG 0.875823 -29 CTACGGGCACTATTATAAATAAATTACTTT 5 92 1 TATTATAAAT 0.948409 -95 TTTATTACTGAATTATAAATTCATTCATTT 5 148 0 AATTATAAAT 0.871749 -39 CCGAATAAAATATTATAACGGAGGTGAAGA 7 89 1 TATTATAACG 0.960713 -73 AAAATGAAAAAATTATTACTACTTCTTAGT 7 118 1 AATTATTACT 0.8118 -44 ********** Masking position 5 Map Score: 0.297947 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 42 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 7 ********** No masking Map Score: -1.59629e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.59629e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.59629e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0