AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i061_Glutamate_Synthase_aquae_reg_100.orf -o061_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00520 62 Aquifex_aeolicus #2 RAA00521 27 Aquifex_aeolicus #3 RAA00527 30 Aquifex_aeolicus #4 RAA01661 39 Aquifex_aeolicus #5 RAA01635 35 Aquifex_aeolicus Motif number 1 CCTCCGAGACCTTTAAAATAGTATCATACCGC 1 17 1 CTTTAAAATT 0.990982 -46 CGCCCTTTGTCGTTAAAATCATGTTTA 1 46 1 CGTTAAAATT 0.994151 -17 TCTGCCACCCCTTAAGAGTTTTGAGAGTAT 3 10 0 CCTTAAGAGT 0.989446 -21 ATAAACTCTCCTTTAAGATATTCAAGTT 4 7 0 CTTTAAGATT 0.995977 -33 AGGTTAAGATGATAAACTCTCCT 4 27 0 GGTTAAGATT 0.99089 -13 ********* * Masking position 6 Map Score: 7.25583 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 27 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 AAAGGGCGGTATGATACTATTTTAAAGGTC 1 24 0 ATGATACTAT 0.983494 -39 TAAGTTTTTATTAGAATATCCTACATT 2 10 1 ATTAGAATAT 0.959022 -18 CTTAAGAGTTTTGAGAGTAT 3 1 0 TTGAGAGTAT 0.990148 -30 AATATCTTAAAGGAGAGTTTATCATCTTAA 4 17 1 AGGAGAGTTT 0.951749 -23 CACCTCACTGTTTATACTATATACTTTAA 5 10 0 TTTATACTAT 0.95187 -26 ********** Masking position 6 Map Score: 3.51307 Number of sites scoring better than the average of aligned sites = 179 Number in coding regions = 162 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 TTTCTACCTCCGAGACCTTTAA 1 3 1 TCTACCTCCG 0.995553 -60 AAAATAGTATCATACCGCCCTTTGTCGTTA 1 31 1 CATACCGCCC 0.994717 -32 TCTGCCACCCCTTAAGAGTT 3 21 0 TCTGCCACCC 0.997123 -10 ********** Masking position 3 Map Score: 0.69657 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 30 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 TTTTAACGACAAAGGGCGGTATGATACTAT 1 34 0 AAAGGGCGGT 0.994805 -29 CAAAACTCTTAAGGGGTGGCAGA 3 18 1 AAGGGGTGGC 0.992831 -13 GAATATCTTAAAGGAGAGTTTATCATCTTA 4 16 1 AAGGAGAGTT 0.974577 -24 TATAGTATAAACAGTGAGGTGAAGGAA 5 19 1 ACAGTGAGGT 0.98288 -17 ********** Masking position 1 Map Score: 1.77915 Number of sites scoring better than the average of aligned sites = 298 Number in coding regions = 271 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0