AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i133_Transmembrane_Transport_7_aquae_reg_300.orf -o133_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01642 300 Aquifex_aeolicus #2 RAA01643 114 Aquifex_aeolicus Motif number 1 TATCCATAACACACCTCCCTTGGAATTTTG 1 27 0 ACACCTCCCT 0.872214 -274 GGCTATTAGAGCTCCTCCGTAAGAAACGAG 1 125 0 GCTCCTCCGT 0.988894 -176 ATTCGGATTCCCCGCTCACTACTGGATAAG 1 184 1 CCCGCTCACT 0.960369 -117 ATTACCGAAAGCTGTGCACTTATCCAGTAG 1 202 0 GCTGTGCACT 0.887519 -99 GGCTTACTCCTCCACTCCGTATTTTTTATC 1 281 0 TCCACTCCGT 0.962261 -20 AGCGGCTACTGCCATTCCGTTCCAGAAGGC 2 19 0 GCCATTCCGT 0.950671 -96 AATGGCAGTAGCCGCTGACTGGATGAGTGC 2 33 1 GCCGCTGACT 0.948229 -82 CTGGATGAGTGCCGCTTCCTTCATCAGTAT 2 51 1 GCCGCTTCCT 0.977679 -64 GGCGTAGAGTGCTCCGCCATACTGATGAAG 2 69 0 GCTCCGCCAT 0.941123 -46 GGCGGAGCACTCTACGCCCTCGGGTACGAC 2 81 1 TCTACGCCCT 0.947165 -34 ********** Masking position 10 Map Score: 8.88736 Number of sites scoring better than the average of aligned sites = 812 Number in coding regions = 738 Number in noncoding regions = 74 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 2 AAATTCCAAGGGAGGTGTGTTATGGATAAA 1 29 1 GGAGGTGTGT 0.958411 -272 AAGAAAAGCTGGAGGCCTACCACAAAGCCA 1 57 1 GGAGGCCTAC 0.907571 -244 CGTTTCTTACGGAGGAGCTCTAATAGCCAA 1 127 1 GGAGGAGCTC 0.990314 -174 GCTCACTACTGGATAAGTGCACAGCTTTCG 1 197 1 GGATAAGTGC 0.955288 -104 AATACGGAGTGGAGGAGTAAGCC 1 288 1 GGAGGAGTAA 0.983446 -13 GCCGCTGACTGGATGAGTGCCGCTTCCTTC 2 43 1 GGATGAGTGC 0.993955 -72 TCATCAGTATGGCGGAGCACTCTACGCCCT 2 71 1 GGCGGAGCAC 0.987581 -44 ********** Masking position 2 Map Score: 8.64406 Number of sites scoring better than the average of aligned sites = 270 Number in coding regions = 247 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 AATCACTGTTTAAAGCGGGAACTACTATATTCG 1 156 1 TAAGCGGGAT 0.98071 -145 TTATCCAGTAGTGAGCGGGGAATCCGAATATAG 1 180 0 GGAGCGGGAT 0.996927 -121 TTCCGTTCCAGAAGGCGGGAATTC 2 2 0 GAGGCGGGAT 0.997891 -113 CACTCATCCAGTCAGCGGCTACTGCCATTCCGT 2 29 0 GCAGCGGCAT 0.989068 -86 TACTGATGAAGGAAGCGGCACTCATCCAGTCAG 2 47 0 GAAGCGGCCC 0.971369 -68 CGTCGTACCCGAGGGCGTAGAGTGCTCCGCCAT 2 79 0 GGGGCGTAAT 0.920841 -36 TATGTAGGCGAGTCGTCGTACCCGAG 2 99 0 GAGGCGAGCT 0.980107 -16 * ******* * * Masking position 7 Map Score: 6.00183 Number of sites scoring better than the average of aligned sites = 200 Number in coding regions = 183 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 TCAGTATTTACATAACAAAATTCCAAGGGAGG 1 12 1 CATAACAAAT 0.990489 -289 TTTCTTTATCCATAACACACCTCCCTTGGAAT 1 31 0 CATAACACAT 0.991183 -270 ATGTAAGGGTCATAACAATTCTGCTCATAATT 1 87 1 CATAACAATT 0.986428 -214 CTCTAATAGCCAAATCACTGTTTAAAGCGGGA 1 144 1 CAAATCACTT 0.904182 -157 CGAAAATCTCCACAACAAAGGTAATTACCGAA 1 223 0 CACAACAAAT 0.983894 -78 ********* * Masking position 7 Map Score: 2.84051 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 11 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: -6.44162e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.44162e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.44162e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0