AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i183_thiamin_biosynthesis_aquae_reg_100.orf -o183_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01395 37 Aquifex_aeolicus #2 RAA01396 163 Aquifex_aeolicus #3 RAA01090 65 Aquifex_aeolicus Motif number 1 TAATATACTCAGCCGGCGTAGCTCAGCGGT 2 81 1 AGCCGGCGTA 0.996058 -83 AGGCTTACGAAGCCCGCGCTCTACCGCTGA 2 103 0 AGCCCGCGCT 0.626027 -61 GGGCTTCGTAAGCCTGAGGTCGTGGGTTCG 2 118 1 AGCCTGAGGT 0.991168 -46 GGTGTTTGAGAGCCGGCGGTGGGATTCGAA 2 144 0 AGCCGGCGGT 0.996455 -20 ********** Masking position 1 Map Score: 7.65587 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 10 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 GAAATTTTTCAGTGATTTAAATATA 1 6 0 AGTGATTTAA 0.980844 -32 AATAATTTAATACTTTAAAT 2 1 1 AATAATTTAA 0.990355 -163 AAATTCGGGAAATAATTTAAAGTATTAAAT 2 15 0 AATAATTTAA 0.990355 -149 GGCTGAGTATATTAATTTAAACATTCATAA 2 65 0 ATTAATTTAA 0.981766 -99 ********** Masking position 5 Map Score: 6.37245 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 10 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 AATATACTCAGCCGGCGTAGCTCAGCGGTA 2 82 1 GCCGGCGTAG 0.9949 -82 GGCTTACGAAGCCCGCGCTCTACCGCTGAG 2 102 0 GCCCGCGCTC 0.882727 -62 GGCTTCGTAAGCCTGAGGTCGTGGGTTCGA 2 119 1 GCCTGAGGTC 0.985835 -45 GTGTTTGAGAGCCGGCGGTGGGATTCGAAC 2 143 0 GCCGGCGGTG 0.992608 -21 ********** Masking position 5 Map Score: 5.50746 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 11 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 TACCTCCAGAAATTTTTCAGTGATTTAAAT 1 14 0 AATTTTTCAG 0.995923 -24 TTATTTCCCGAATTTTTCAGGTGTTGAAAA 2 30 1 AATTTTTCAG 0.995923 -134 ACCTTATTTTCCAGTTCTTATAAG 3 52 0 TATTTTCCAG 0.991486 -14 ********** Masking position 2 Map Score: 4.2241 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 23 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 CCTCCAGAAATTTTTCAGTGATTTAAATAT 1 12 0 TTTTTCAGTG 0.99222 -26 ATTTCCCGAATTTTTCAGGTGTTGAAAAGG 2 32 1 TTTTTCAGGT 0.99222 -132 ACCTTATTTTCCAGTTCTTATAAGAG 3 50 0 TTTTCCAGTT 0.99222 -16 ********** Masking position 7 Map Score: 2.21567 Number of sites scoring better than the average of aligned sites = 82 Number in coding regions = 70 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 6 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0