AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i183_thiamin_biosynthesis_aquae_reg_300.orf -o183_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01395 37 Aquifex_aeolicus #2 RAA01396 163 Aquifex_aeolicus #3 RAA01090 65 Aquifex_aeolicus Motif number 1 ACCGCTGAGCTACGCCGGCTGAGTATATTA 2 81 0 TACGCCGGCT 0.995457 -83 TCAGCGGTAGAGCGCGGGCTTCGTAAGCCT 2 103 1 AGCGCGGGCT 0.641308 -61 CGAACCCACGACCTCAGGCTTACGAAGCCC 2 118 0 ACCTCAGGCT 0.990613 -46 TTCGAATCCCACCGCCGGCTCTCAAACACC 2 144 1 ACCGCCGGCT 0.996799 -20 ********** Masking position 10 Map Score: 7.65587 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 10 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 GAAATTTTTCAGTGATTTAAATATA 1 6 0 AGTGATTTAA 0.984296 -32 AATAATTTAATACTTTAAAT 2 1 1 AATAATTTAA 0.992063 -163 AAATTCGGGAAATAATTTAAAGTATTAAAT 2 15 0 AATAATTTAA 0.992063 -149 GGCTGAGTATATTAATTTAAACATTCATAA 2 65 0 ATTAATTTAA 0.984431 -99 ********** Masking position 5 Map Score: 6.37245 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 10 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 TACCGCTGAGCTACGCCGGCTGAGTATATT 2 82 0 CTACGCCGGC 0.9949 -82 CTCAGCGGTAGAGCGCGGGCTTCGTAAGCC 2 102 1 GAGCGCGGGC 0.882727 -62 TCGAACCCACGACCTCAGGCTTACGAAGCC 2 119 0 GACCTCAGGC 0.985835 -45 GTTCGAATCCCACCGCCGGCTCTCAAACAC 2 143 1 CACCGCCGGC 0.992608 -21 ********** Masking position 6 Map Score: 5.50746 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 11 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 TATTTAAATCACTGAAAAATTTCTGGAGGT 1 13 1 ACTGAAAAAT 0.995668 -25 CTTTTCAACACCTGAAAAATTCGGGAAATA 2 31 0 CCTGAAAAAT 0.99495 -133 TCTTATAAGAACTGGAAAATAAGGT 3 51 1 ACTGGAAAAT 0.994867 -15 ********** Masking position 6 Map Score: 4.2241 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 9 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ATCACTGAAAAATTTCTGGAGGTAGCCA 1 20 1 AATTTCTGGA 0.981819 -18 AACACCTGAAAAATTCGGGAAATAATTTAA 2 25 0 AAATTCGGGA 0.98766 -139 GTTGAAAAGGAAATTATGAATGTTTAAATT 2 52 1 AAATTATGAA 0.956902 -112 TTTATTAATAACATTCTAAAACTCTTATAA 3 29 1 ACATTCTAAA 0.928692 -37 ********** Masking position 5 Map Score: 0.393959 Number of sites scoring better than the average of aligned sites = 280 Number in coding regions = 271 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 6 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0