AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i190_ribonucleoside_diphos___aquae_reg_100.orf -o190_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01047 85 Aquifex_aeolicus #2 RAA01049 20 Aquifex_aeolicus #3 RAA00481 105 Aquifex_aeolicus Motif number 1 CTGTCTTATGAATAATTTTCGCCCGGCTAT 1 17 1 AATAATTTTC 0.987233 -69 ACGGACAATCAAAAATTTTCTTGAAGAGAG 1 50 1 AAAAATTTTC 0.900446 -36 TGAAGAGAGGTAGAATTCTCAAATC 1 71 1 TAGAATTCTC 0.855051 -15 TCGTGTTAAATTATATTCTC 2 3 0 AATTATATTC 0.948549 -18 ACCTCTTTTCATGAATTTTCTACTTCCAAA 3 22 1 ATGAATTTTC 0.986162 -84 AGGATTTAGGATTTATTTTCGGGGCAACAC 3 62 1 ATTTATTTTC 0.975929 -44 ********** Masking position 5 Map Score: 8.60331 Number of sites scoring better than the average of aligned sites = 111 Number in coding regions = 91 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 2 AAAATTTTCTTGAAGAGAGGTAGAATTCTC 1 61 1 TGAAGAGAGG 0.998591 -25 AGAAAATTCATGAAAAGAGGTGTTATAATA 3 13 0 TGAAAAGAGG 0.996167 -93 GTTTACCTCCTGAAGGGTGGAGTGTTGCCC 3 83 0 TGAAGGGTGG 0.997049 -23 ********** Masking position 4 Map Score: 5.09002 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 21 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 TTTTCTTGAAGAGAGGTAGAATTCTCAAAT 1 65 1 GAGAGGTAGA 0.993459 -21 CACAGGAATTTGGAAGTAGAAAATTCATGA 3 30 0 TGGAAGTAGA 0.990285 -76 TCCACCCTTCAGGAGGTAAACCAA 3 92 1 AGGAGGTAAA 0.990339 -14 ********** Masking position 4 Map Score: 0.767972 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 40 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 4 AAATTATTCATAAGACAGCATTTT 1 5 0 TAAGACAGCA 0.951714 -81 TTCGCCCGGCTATGACACGGACAATCAAAA 1 34 1 TATGACACGG 0.991167 -52 GAGAATATAATTTAACACGA 2 11 1 TTTAACACGA 0.971557 -10 GTTATTATAACACCTCTTTTCATGA 3 6 1 TATAACACCT 0.979978 -100 ********** Masking position 5 Map Score: 0.153793 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 33 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 TGTCTTATGAATAATTTTCGCCCGGCTATG 1 18 1 ATAATTTTCG 0.951246 -68 TCTCTTCAAGAAAATTTTTGATTGTCCGTG 1 49 0 AAAATTTTTG 0.928775 -37 ACCTCTTTTCATGAATTTTCTACTTCCAAA 3 22 1 ATGAATTTTC 0.912672 -84 ATCCTTCCACAGGAATTTGGAAGTAGAAAA 3 37 0 AGGAATTTGG 0.988452 -69 TTCCTGTGGAAGGATTTAGGATTTATTTTC 3 52 1 AGGATTTAGG 0.974649 -54 ********** Masking position 6 Map Score: 0.837232 Number of sites scoring better than the average of aligned sites = 296 Number in coding regions = 278 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0