AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_aquae_reg_300.orf -o194_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00545 31 Aquifex_aeolicus #2 RAA00551 66 Aquifex_aeolicus #3 RAA00585 38 Aquifex_aeolicus #4 RAA00469 66 Aquifex_aeolicus #5 RAA00774 178 Aquifex_aeolicus Motif number 1 TTTCCCTTATAATACCTTCCT 1 21 1 AATACCTTCC 0.908184 -11 TTTTTATTGTAAAACATTCTCACTTCTTTT 2 27 0 AAAACATTCT 0.941198 -40 GTTTTACAATAAAAAATTCTGTCTGGAGGA 2 42 1 AAAAAATTCT 0.967744 -25 TTAACTTTAATAAATTTTTAGAGTTAGG 3 9 1 AATAAATTTT 0.926572 -30 TGTCAAGCTGAAGAAATACCTGTAAAATCA 4 15 0 AAGAAATACC 0.9578 -52 TCAGAAATAAAATAAATTCTTTTGAGTG 4 49 1 AATAAATTCT 0.983657 -18 CCTCCTGGTTAGTAAATTCTAATCCACTTT 5 17 1 AGTAAATTCT 0.962099 -162 TCCACTTTACAGGAAATTTCACGAGGTTTA 5 39 1 AGGAAATTTC 0.873596 -140 AGGGTCCTAAAACAAATACCCTCCAGAGGT 5 154 1 AACAAATACC 0.925008 -25 ********** Masking position 4 Map Score: 10.3001 Number of sites scoring better than the average of aligned sites = 437 Number in coding regions = 395 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 2 AGGTATTATAAGGGAAAGGGAAGGGGA 1 8 0 AGGGAAAGGG 0.97958 -24 AGCCCTGCGGCGGGACAGGGTGAACTCCCC 5 81 1 CGGGACAGGG 0.99823 -98 TGCTCCCTTTCGGGCCTGGGGGAGTTCACC 5 99 0 CGGGCCTGGG 0.998387 -80 GGCCCGAAAGGGAGCAAGGGTAAGCCCGCC 5 113 1 GGAGCAAGGG 0.98582 -66 ACCCTGCGCACGGGACGGCGGGCTTACCCT 5 129 0 CGGGACGGCG 0.994214 -50 ATTTGTTTTAGGACCCTGCGCACGGGACGG 5 141 0 GGACCCTGCG 0.945079 -38 ********** Masking position 8 Map Score: 7.78207 Number of sites scoring better than the average of aligned sites = 175 Number in coding regions = 153 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 AAAAATTCTGTCTGGAGGAAGTTA 2 53 1 TCTGGAGGAA 0.989558 -14 ATTTTTAGAGTTAGGAGGTAAGAGA 3 24 1 TTAGGAGGTA 0.954561 -15 AATTTACTAACCAGGAGGTGTAAA 5 5 0 CCAGGAGGTG 0.99429 -174 ACAGGAAATTTCACGAGGTTTATATTTATT 5 47 1 TCACGAGGTT 0.968882 -132 CCCTTTCGGGCCTGGGGGAGTTCACCCTGT 5 95 0 CCTGGGGGAG 0.977991 -84 TTATTACCTCTGGAGGGTATTTGTTTTA 5 161 0 TCTGGAGGGT 0.987601 -18 ********** Masking position 5 Map Score: 5.83404 Number of sites scoring better than the average of aligned sites = 423 Number in coding regions = 373 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 4 TTACCTCCTAACTCTAAAAATTTATTAAAG 3 15 0 ACTCTAAAAA 0.964946 -24 TGAAGAAATACCTGTAAAATCAAATT 4 7 0 CCTGTAAAAT 0.976482 -60 CACTCAAAAGAATTTATTTTA 4 56 0 ACTCAAAAGA 0.944008 -11 CGTGAAATTTCCTGTAAAGTGGATTAGAAT 5 32 0 CCTGTAAAGT 0.951415 -147 ********** Masking position 6 Map Score: 0.465958 Number of sites scoring better than the average of aligned sites = 82 Number in coding regions = 76 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0