AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i196_mixed_replication_rec__aquae_reg_100.orf -o196_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01468 39 Aquifex_aeolicus #2 RAA00012 74 Aquifex_aeolicus Motif number 1 AATTCTAAAGCTATAAAATTTTGAGT 1 6 0 CTATAAATTT 0.993711 -34 AATTTTATAGCTTTAGAATTTATTATCCAGA 1 17 1 CTTTAAATTT 0.997508 -23 ATTAAGGAATTTTTATATTTTAATTCACAAA 2 33 0 TTTTAATTTT 0.975542 -42 ATAAAAATTCCTTAATAATTTTACAAGGGTC 2 48 1 CTTAAAATTT 0.993729 -27 ***** ***** Masking position 5 Map Score: 6.27368 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 62 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 ATTCTAAAGCTATAAAATTTTGAGT 1 6 0 TATAAAATTT 0.923438 -34 AATCTGGATAATAAATTCTAAAGC 1 26 0 TGGATAATAA 0.965561 -14 GAAAAGAGTTTGTGAATTAAAATATAAAAA 2 25 1 TGTGAATTAA 0.965637 -50 AATAGACCCTTGTAAAATTATTAAGGAATT 2 53 0 TGTAAAATTA 0.991782 -22 ********** Masking position 6 Map Score: 0.705723 Number of sites scoring better than the average of aligned sites = 158 Number in coding regions = 119 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0