AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i231_protease_clp_aquae_reg_100.orf -o231_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00941 32 Aquifex_aeolicus #2 RAA00271 19 Aquifex_aeolicus #3 RAA01704 23 Aquifex_aeolicus #4 RAA00300 18 Aquifex_aeolicus Motif number 1 TTCTCCTCCTTGTTTTTAAAATTATACCA 1 10 0 TGTTTTTAAA 0.995294 -23 AGGCTTAAGTTTTTAAACC 2 8 1 AGTTTTTAAA 0.997632 -12 AATAGATATTTTAAAGAT 4 4 0 ATATTTTAAA 0.988939 -15 ********** Masking position 8 Map Score: 5.67032 Number of sites scoring better than the average of aligned sites = 119 Number in coding regions = 109 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 TGGTATAATTTTAAAAACAAGGAG 1 5 1 ATAATTTTAA 0.824702 -28 GGTTTAAAAACTTAAGCCT 2 5 0 AAAAACTTAA 0.981312 -15 ACCCGCTAAATAGTTAATTATAT 3 7 0 AAATAGTTAA 0.98921 -17 ATCTTTAAAATATCTATT 4 8 1 AAATATCTAT 0.949234 -11 ********** Masking position 3 Map Score: 2.63344 Number of sites scoring better than the average of aligned sites = 405 Number in coding regions = 320 Number in noncoding regions = 85 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 3 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0