AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i262_3_5_1_28_aquae_reg_300.orf -o262_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01586 18 Aquifex_aeolicus #2 RAA00631 49 Aquifex_aeolicus #3 RAA00620 65 Aquifex_aeolicus Motif number 1 GTGTTAAAATCCTCTTTAGGAGTAAGTTTA 2 11 1 CCTCTTTAGG 0.990655 -39 GTTTTGCCCCTCTTTCAGATAAACTTAC 2 32 0 CCTCTTTCAG 0.998062 -18 AAAGAAGCACCCTTTTTCTCATAACCCCCA 3 35 0 CCTTTTTCTC 0.995823 -31 AAAAAGGGTGCTTCTTTCTCTATTACTT 3 48 1 CTTCTTTCTC 0.995824 -18 ********** Masking position 5 Map Score: 6.72456 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 101 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 TTGTTAATATTTTTCCTT 1 9 0 TTGTTAATAT 0.881963 -10 GTGTTAAAATCCTCTTTAGG 2 1 1 GTGTTAAAAT 0.965153 -49 AGTATTAAGATTAATACAATC 3 2 1 GTATTAAGAT 0.885996 -64 ********** Masking position 6 Map Score: 2.49933 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 8 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0