AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i267_hypothetical12_aquae_reg_100.orf -o267_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01463 148 Aquifex_aeolicus #2 RAA01560 69 Aquifex_aeolicus #3 RAA01561 17 Aquifex_aeolicus Motif number 1 GGTTCGAGTCCCGCCGGGCACACCACTTAA 1 14 0 CCGCCGGGCA 0.999174 -135 ATCCGCCTGAGCTACGGGCACTACCACTAA 1 75 1 GCTACGGGCA 0.996324 -74 CTTTCCACCTCCGGTTAGTATATTCTA 2 53 0 CCTCCGGTTA 0.994418 -17 AAAACTCCTCCGGGCCT 3 2 0 CCTCCGGGCC 0.997878 -16 ********** Masking position 5 Map Score: 7.93671 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 23 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CGCCGGGCACACCACTTAATCT 1 3 0 ACCACTTAAT 0.991759 -146 TACGGGCACTACCACTAAATAAATATTATA 1 87 1 ACCACTAAAT 0.994252 -62 AATCCTTAAATTTTAATTCCT 1 138 0 ATCCTTAAAT 0.973538 -11 TTACTTAATTATCCTTTAATTTATTTTTAT 2 11 1 ATCCTTTAAT 0.962457 -59 TATATTCTAACCCACTACATAATAAAAATA 2 32 0 CCCACTACAT 0.972313 -38 ********** Masking position 6 Map Score: 5.10694 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 46 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 CCCGTAGCTCAGGCGGATAGAGCGCGAGAT 1 63 0 AGGCGGATAG 0.997431 -86 CTTTTTCTGTAGGCGAAAGGATATATAATA 1 110 0 AGGCGAAAGG 0.995282 -39 TACTAACCGGAGGTGGAAAG 2 60 1 AGGTGGAAAG 0.996031 -10 ********** Masking position 7 Map Score: 3.08868 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 28 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 CCCGGCGGGACTCGAACCCGCGACCTCGAG 1 26 1 CTCGAACCCG 0.992472 -123 GATTCCTAATCTCGAGGTCGCGGGTTCGAG 1 36 0 CTCGAGGTCG 0.996951 -113 GATTAGGAATCTCGCGCTCTATCCGCCTGA 1 55 1 CTCGCGCTCT 0.994377 -94 AAAACTCCTCCGGGCCT 3 1 0 CTCCGGGCCT 0.99073 -17 ********** Masking position 2 Map Score: 2.85886 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 24 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ACTACCACTAAATAAATATTATATATCCTT 1 94 1 AATAAATATT 0.778997 -55 CAGAAAAAGGAATTAAAATTTAAGGATT 1 131 1 AATTAAAATT 0.778997 -18 CCCACTACATAATAAAAATAAATTAAAGGA 2 22 0 AATAAAAATA 0.957835 -48 ********** Masking position 5 Map Score: 0.99145 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 32 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0