AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i270_hypothetical15_aquae_reg_300.orf -o270_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01204 80 Aquifex_aeolicus #2 RAA01206 40 Aquifex_aeolicus Motif number 1 CTTATCTTAAATAAAGGAGGAGAAAG 1 7 0 ATAAAGGAGG 0.998155 -74 TCTAAAAACTTTAAAGGAGGTAGCGGA 1 64 1 TTAAAGGAGG 0.995352 -17 AAGGAAAAGGAGAAAGGGAGA 2 2 0 AGAAAGGGAG 0.996859 -39 TAATCTTAAAAGAAAGGAAAAGGAGAAAGG 2 15 0 AGAAAGGAAA 0.99271 -26 ********** Masking position 5 Map Score: 7.91504 Number of sites scoring better than the average of aligned sites = 280 Number in coding regions = 257 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 AGAGTTACACTTATCTTAAATAAAGGAGGA 1 16 0 TTATCTTAAA 0.980249 -65 AGATAAGTGTAACTCTTACATACTGATATA 1 30 1 AACTCTTACA 0.967943 -51 CATACTGATATAATCTTCTAAAAACTTTAA 1 48 1 TAATCTTCTA 0.974298 -33 TAATCTTCTAAAAACTTTAAAGGAGGTAGC 1 58 1 AAAACTTTAA 0.931907 -23 AAGATTTAATCTTAAAAGAAAGGAAA 2 25 0 TAATCTTAAA 0.993908 -16 ********** Masking position 6 Map Score: 4.8656 Number of sites scoring better than the average of aligned sites = 205 Number in coding regions = 179 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 TCAGTATGTAAGAGTTACACTTATCTTAAA 1 26 0 AGAGTTACAC 0.985812 -55 TCTTACATACTGATATAATCTTCTAAAAAC 1 43 1 TGATATAATC 0.98231 -38 AAGATTTAATCTTAAAAGAAA 2 30 0 AGATTTAATC 0.99426 -11 ********** Masking position 7 Map Score: 0.890733 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 29 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0