AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i282_hypothetical7_aquae_reg_300.orf -o282_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00475 120 Aquifex_aeolicus Motif number 1 GGTTTCCACCTCCTTTTACTTTA 1 4 1 TTCCACCTCC 0.996898 -117 TTCCACCTCCTTTTACTTTAAGTATTTTGG 1 14 1 TTTTACTTTA 0.891259 -107 GAGTTAGAATTTTTAATACCAAAATACTTA 1 32 0 TTTTAATACC 0.928929 -89 GTATTAAAAATTCTAACTCAAGTTATTTAA 1 43 1 TTCTAACTCA 0.993663 -78 CTATACTTAATTTTAACTCAGAATATGACT 1 89 0 TTTTAACTCA 0.990071 -32 TTTGTCCACCTCCTATACTTAAT 1 108 0 GTCCACCTCC 0.991562 -13 ********** Masking position 5 Map Score: 8.33084 Number of sites scoring better than the average of aligned sites = 964 Number in coding regions = 791 Number in noncoding regions = 173 Number of orfs with sites within 600 bp upstream = 163 Fraction of orfs with sites within 600 bp upstream = 0.0261805 Motif number 2 TAATACCAAAATACTTAAAGTAAAAGGAGG 1 19 0 ATACTTAAAG 0.942094 -102 AATTCTAACTCAAGTTATTTAAAAACTCAT 1 51 1 CAAGTTATTT 0.940799 -70 AGTTATTTAAAAACTCATATGTCAAAAGTC 1 63 1 AAACTCATAT 0.986989 -58 TCATATGTCAAAAGTCATATTCTGAGTTAA 1 77 1 AAAGTCATAT 0.981462 -44 TCCACCTCCTATACTTAATTTTAACTCAGA 1 97 0 ATACTTAATT 0.961776 -24 ********** Masking position 5 Map Score: 2.67509 Number of sites scoring better than the average of aligned sites = 180 Number in coding regions = 153 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 3 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0