AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i301_mixed16_aquae_reg_100.orf -o301_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00292 187 Aquifex_aeolicus Motif number 1 CAAATCCCGCCCCCGCAACCATATCACCAG 1 32 0 CCCCGCAACC 0.998644 -156 CGGGATTTGAACCCGCGACCTCCGGGTTAT 1 53 1 ACCCGCGACC 0.993774 -135 GGGTTATGAGCCCGGCGAGCTACCAGGCTG 1 76 1 CCCGGCGAGC 0.995035 -112 AGCTACCAGGCTGCTCCACCCCGCGTTGCC 1 93 1 CTGCTCCACC 0.982539 -95 AAAATCTTATCTCGTCAAGTCCCCTTTCCC 1 142 1 CTCGTCAAGT 0.936084 -46 AGTCCCCTTTCCCCTCCACTTGAGTTAAAA 1 159 1 CCCCTCCACT 0.995936 -29 ********** Masking position 8 Map Score: 9.22325 Number of sites scoring better than the average of aligned sites = 256 Number in coding regions = 210 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 ATTAGATACTGGTGATATGGTTGCGGGGGC 1 24 1 GGTGATATGG 0.986842 -164 GTTGCGGGGGCGGGATTTGAACCCGCGACC 1 43 1 CGGGATTTGA 0.99189 -145 CCGCGACCTCCGGGTTATGAGCCCGGCGAG 1 65 1 CGGGTTATGA 0.991891 -123 GGGGACTTGACGAGATAAGATTTTTTCTAT 1 136 0 CGAGATAAGA 0.975642 -52 CTCAAGTGGAGGGGAAAGGGGACTTGACGA 1 153 0 GGGGAAAGGG 0.981543 -35 ********** Masking position 4 Map Score: 4.2632 Number of sites scoring better than the average of aligned sites = 176 Number in coding regions = 157 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 GGGCGGGATTTGAACCCGCGACCTCCGGGT 1 50 1 TGAACCCGCG 0.99077 -138 CTCCGGGTTATGAGCCCGGCGAGCTACCAG 1 72 1 TGAGCCCGGC 0.994669 -116 GCGGGGTGGAGCAGCCTGGTAGCTCGCCGG 1 87 0 GCAGCCTGGT 0.983408 -101 TAATAATTTGGCAACGCGGGGTGGAGCAGC 1 102 0 GCAACGCGGG 0.984316 -86 ********** Masking position 3 Map Score: 1.06333 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 41 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 GGGATTTTATTTTATTAGAT 1 1 1 GGGATTTTAT 0.987319 -187 TTAGATACTGGTGATATGGTTGCGGGGGCG 1 25 1 GTGATATGGT 0.947391 -163 TTGCGGGGGCGGGATTTGAACCCGCGACCT 1 44 1 GGGATTTGAA 0.962348 -144 TTGACGAGATAAGATTTTTTCTATATATTA 1 130 0 AAGATTTTTT 0.90489 -58 GAGGAGATATTTTAACTCAAGTG 1 175 0 GAGATATTTT 0.970725 -13 ********** Masking position 5 Map Score: 1.89661 Number of sites scoring better than the average of aligned sites = 337 Number in coding regions = 299 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0