AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i301_mixed16_aquae_reg_300.orf -o301_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00292 187 Aquifex_aeolicus Motif number 1 CTGGTGATATGGTTGCGGGGGCGGGATTTG 1 32 1 GGTTGCGGGG 0.998651 -156 ATAACCCGGAGGTCGCGGGTTCAAATCCCG 1 53 0 GGTCGCGGGT 0.993802 -135 CAGCCTGGTAGCTCGCCGGGCTCATAACCC 1 76 0 GCTCGCCGGG 0.995043 -112 GGCAACGCGGGGTGGAGCAGCCTGGTAGCT 1 93 0 GGTGGAGCAG 0.982637 -95 GGGAAAGGGGACTTGACGAGATAAGATTTT 1 142 0 ACTTGACGAG 0.936425 -46 TTTTAACTCAAGTGGAGGGGAAAGGGGACT 1 159 0 AGTGGAGGGG 0.995959 -29 ********** Masking position 3 Map Score: 9.22325 Number of sites scoring better than the average of aligned sites = 256 Number in coding regions = 210 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 ATTAGATACTGGTGATATGGTTGCGGGGGC 1 24 1 GGTGATATGG 0.986115 -164 GTTGCGGGGGCGGGATTTGAACCCGCGACC 1 43 1 CGGGATTTGA 0.991439 -145 CCGCGACCTCCGGGTTATGAGCCCGGCGAG 1 65 1 CGGGTTATGA 0.99144 -123 GGGGACTTGACGAGATAAGATTTTTTCTAT 1 136 0 CGAGATAAGA 0.974313 -52 CTCAAGTGGAGGGGAAAGGGGACTTGACGA 1 153 0 GGGGAAAGGG 0.980527 -35 ********** Masking position 4 Map Score: 4.2632 Number of sites scoring better than the average of aligned sites = 176 Number in coding regions = 157 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 GGGCGGGATTTGAACCCGCGACCTCCGGGT 1 50 1 TGAACCCGCG 0.991188 -138 CTCCGGGTTATGAGCCCGGCGAGCTACCAG 1 72 1 TGAGCCCGGC 0.994798 -116 GCGGGGTGGAGCAGCCTGGTAGCTCGCCGG 1 87 0 GCAGCCTGGT 0.984052 -101 TAATAATTTGGCAACGCGGGGTGGAGCAGC 1 102 0 GCAACGCGGG 0.984127 -86 ********** Masking position 3 Map Score: 1.06333 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 41 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 ATCTAATAAAATAAAATCCC 1 1 0 ATAAAATCCC 0.987247 -187 CGCCCCCGCAACCATATCACCAGTATCTAA 1 25 0 ACCATATCAC 0.947109 -163 AGGTCGCGGGTTCAAATCCCGCCCCCGCAA 1 44 0 TTCAAATCCC 0.962141 -144 TAATATATAGAAAAAATCTTATCTCGTCAA 1 130 1 AAAAAATCTT 0.904411 -58 CACTTGAGTTAAAATATCTCCTC 1 175 1 AAAATATCTC 0.970581 -13 ********** Masking position 6 Map Score: 1.89661 Number of sites scoring better than the average of aligned sites = 337 Number in coding regions = 299 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0