AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i319_mixed4_aquae_reg_100.orf -o319_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01527 35 Aquifex_aeolicus #2 RAA00564 129 Aquifex_aeolicus #3 RAA01083 37 Aquifex_aeolicus Motif number 1 TTATTATATAAGTGGTAAGGAGTTTACG 1 18 1 AGTGGTAAGG 0.965683 -18 TCTTGGCTATCCGGGGTAGCTCAATCGGCA 2 33 1 CCGGGGTAGC 0.993336 -97 CAATCGGCAGAGCGGGTGGCTGTTAACCAC 2 54 1 AGCGGGTGGC 0.991605 -76 CTGTTAACCACCTGGTTGGGGGTTCGAGTC 2 73 1 CCTGGTTGGG 0.992059 -57 GAAATGGCTCCGGGGGAGGGACTCGAACCC 2 92 0 CGGGGGAGGG 0.997991 -38 ********** Masking position 5 Map Score: 5.35841 Number of sites scoring better than the average of aligned sites = 181 Number in coding regions = 157 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 CACTTATATAATAAGTTTAAC 1 2 0 ATAAGTTTAA 0.942804 -34 ATAAGTGGTAAGGAGTTTACG 1 25 1 AGGAGTTTAC 0.993565 -11 ACCCCCAACCAGGTGGTTAACAGCCACCCG 2 66 0 AGGTGGTTAA 0.993835 -64 AGTAAAACTCAGGAGGTTAAAA 3 26 1 AGGAGGTTAA 0.997548 -12 ********** Masking position 7 Map Score: 5.35212 Number of sites scoring better than the average of aligned sites = 136 Number in coding regions = 120 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 GTTAAACTTATTATATAAGTGGTAAG 1 6 1 ACTTATATAT 0.973799 -30 AAATTAAGGTTTTATAATTTTA 2 2 1 AATTAAGTTT 0.975507 -128 AGGAATTATTGTATTGTGGAAATG 2 116 0 AATTATGTAT 0.97491 -14 CCTGAGTTTTACTTAAAATTTATACTTT 3 8 0 ACTTAAATTT 0.97491 -30 ****** **** Masking position 5 Map Score: 1.34636 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 33 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 CCGGATAGCCAAGATAAAATTATAAAACCT 2 17 0 AAGATAAAAT 0.965075 -113 AAAGTATAAATTTTAAGTAAA 3 2 1 AAGTATAAAT 0.976716 -36 TATAAATTTTAAGTAAAACTCAGGAGGTTA 3 15 1 AAGTAAAACT 0.984546 -23 ********** Masking position 7 Map Score: 0.357849 Number of sites scoring better than the average of aligned sites = 91 Number in coding regions = 78 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 5 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0