AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i319_mixed4_aquae_reg_300.orf -o319_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01527 35 Aquifex_aeolicus #2 RAA00385 55 Aquifex_aeolicus #3 RAA00564 129 Aquifex_aeolicus #4 RAA01083 37 Aquifex_aeolicus Motif number 1 TATAAGTGGTAAGGAGTTTACG 1 24 1 AAGGAGTTTA 0.961873 -12 CGAGAACTTCAAGGAGGCGGAA 2 3 0 AAGGAGGCGG 0.985725 -53 ATCGGCAGAGCGGGTGGCTGTTAACCACCT 3 56 1 CGGGTGGCTG 0.990742 -74 AACCCCCAACCAGGTGGTTAACAGCCACCC 3 67 0 CAGGTGGTTA 0.995188 -63 AAGTAAAACTCAGGAGGTTAAAA 4 25 1 CAGGAGGTTA 0.996636 -13 ********** Masking position 6 Map Score: 6.49079 Number of sites scoring better than the average of aligned sites = 138 Number in coding regions = 110 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 2 GTTAAACTTATTATATAAGTGGTAA 1 3 1 TAAATTTTTA 0.953645 -33 TTACAGTCGTTAAAATGTTTTTACGAGAACTTC 2 23 0 TAAATGTTTA 0.754536 -33 TAAATTTAATTTACAGTCGTTAA 2 43 0 TAAATTATTA 0.539958 -13 ATAGCCAAGATAAAATTATAAAACCTTAATTT 3 10 0 TAAATTTAAA 0.954243 -120 AAAGTATAAATTTTAAGTAAAACTCAGGA 4 7 1 TAAATTAATA 0.979187 -31 **** ** ** ** Masking position 6 Map Score: 3.2975 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 33 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 CTGCCGATTGAGCTACCCCGGATAGCCAAG 3 34 0 AGCTACCCCG 0.992218 -96 AACAGCCACCCGCTCTGCCGATTGAGCTAC 3 48 0 CGCTCTGCCG 0.994301 -82 GGGAGGGACTCGAACCCCCAACCAGGTGGT 3 79 0 CGAACCCCCA 0.980629 -51 GGGTTCGAGTCCCTCCCCCGGAGCCATTTC 3 92 1 CCCTCCCCCG 0.99867 -38 ********** Masking position 8 Map Score: 2.87113 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 84 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0