AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i327_not_clear2_aquae_reg_100.orf -o327_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00391 54 Aquifex_aeolicus #2 RAA00641 24 Aquifex_aeolicus #3 RAA00643 18 Aquifex_aeolicus Motif number 1 AGGTTATTTTAACATAAAATTTTAAGTCTGGA 1 11 0 AACATAATTT 0.943294 -44 ATTTTATGTTAAAATAACCTCTCTCGTAAAAG 1 23 1 AAAATACTCT 0.993265 -32 CACTAAGATTAAAATACCTTTTTT 2 11 1 AAAATACTTT 0.710895 -14 AAAATATCTTTAATTATC 3 1 1 AAAATACTTA 0.709063 -18 ****** * *** Masking position 6 Map Score: 6.41847 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 44 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 TAACATAAAATTTTAAGTCTGGA 1 4 0 TTTTAAGTCT 0.977014 -51 GAGAGAGGTTATTTTAACATAAAATTTTAA 1 18 0 ATTTTAACAT 0.760298 -37 AAAAAAGGTATTTTAATCTTAGTG 2 6 0 ATTTTAATCT 0.962751 -19 AAAATATCTTTAATTATC 3 8 1 CTTTAATTAT 0.964762 -11 ********** Masking position 6 Map Score: 1.85172 Number of sites scoring better than the average of aligned sites = 246 Number in coding regions = 207 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0