AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i346_weak7_aquae_reg_100.orf -o346_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01493 138 Aquifex_aeolicus Motif number 1 TCGACTCCGCCCTGGGCCACCA 1 3 0 CCTGGGCCAC 0.994005 -136 CGGGGTGTCGGCGGTTCGACTCCGCCCTGG 1 18 0 GCGGTTCGAC 0.978634 -121 CGGCTGAAAACCGGGGTGTCGGCGGTTCGA 1 29 0 CCGGGGTGTC 0.996813 -110 CGGTTTTCAGCCGGGTGCTCTACCACCTGA 1 46 1 CCGGGTGCTC 0.998748 -93 GTCGTAAGGCCCGGTAGCTCAGGTGGTAGA 1 64 0 CCGGTAGCTC 0.994816 -75 ********** Masking position 4 Map Score: 7.26061 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 82 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GGTGCTCTACCACCTGAGCTACCGGGCCTT 1 59 1 CACCTGAGCT 0.998407 -80 TAAATTATGACACTTGAACTCAAAGGGAAT 1 114 0 CACTTGAACT 0.996655 -25 ********** Masking position 5 Map Score: 0.769067 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0