AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i346_weak7_aquae_reg_300.orf -o346_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01468 39 Aquifex_aeolicus #2 RAA01493 138 Aquifex_aeolicus Motif number 1 TCGACTCCGCCCTGGGCCACCA 2 3 0 CCTGGGCCAC 0.992027 -136 CGGGGTGTCGGCGGTTCGACTCCGCCCTGG 2 18 0 GCGGTTCGAC 0.972369 -121 CGGCTGAAAACCGGGGTGTCGGCGGTTCGA 2 29 0 CCGGGGTGTC 0.995753 -110 CGGTTTTCAGCCGGGTGCTCTACCACCTGA 2 46 1 CCGGGTGCTC 0.998336 -93 GTCGTAAGGCCCGGTAGCTCAGGTGGTAGA 2 64 0 CCGGTAGCTC 0.99325 -75 ********** Masking position 4 Map Score: 6.14821 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 82 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 TTCTAAAGCTATAAAATTTTGAGT 1 5 0 ATAAAATTTT 0.713591 -35 AATCTGGATAATAAATTCTAAAGCTAT 1 23 0 ATAATAAATT 0.971527 -17 AATGGAATATATAATATATTTTTGTCGTAA 2 87 0 ATAATATATT 0.915472 -52 TTCAAGTGTCATAATTTAATTGT 2 126 1 ATAATTTAAT 0.713591 -13 ********** Masking position 4 Map Score: 2.96425 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 21 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 3 GGTGCTCTACCACCTGAGCTACCGGGCCTT 2 59 1 CACCTGAGCT 0.998032 -80 TAAATTATGACACTTGAACTCAAAGGGAAT 2 114 0 CACTTGAACT 0.995804 -25 ********** Masking position 5 Map Score: 0.325101 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0