AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i016_Pentose_Phosphate_Shunt_aful_reg_100.orf -o016_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG21749 39 Archaeoglobus_fulgidus #2 RAG45764 139 Archaeoglobus_fulgidus Motif number 1 TTTAATCTTTTTTCTGCCAAGACCAGAC 1 22 1 TTTCTGCAGA 0.967416 -18 TTTCATTTTTCTGTCAGAATGAGCTTCAG 2 8 1 TTTCTGCAAA 0.988573 -132 TCAGACGCAATTTCAGGTGGAATTCTGAAGCT 2 32 0 TTTCAGTGAA 0.841781 -108 CTGGATAGAATTTCAAAGGAAATCAGACGCAA 2 54 0 TTTCAAGGAA 0.784185 -86 CCTTATTGAGTTTGAGAGGTAAACACCGAAGA 2 90 0 TTTGAGGGAA 0.988276 -50 AGCAGATTTGCTGAGGGAATGCATAAAGC 2 121 0 TTGCTGGGAA 0.98851 -19 ****** ** ** Masking position 2 Map Score: 5.99491 Number of sites scoring better than the average of aligned sites = 512 Number in coding regions = 481 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 2 TCTGAAGCTCATTCTGACAGAAAAATGAAA 2 11 0 ATTCTGACAG 0.918145 -129 GAGCTTCAGAATTCCACCTGAAATTGCGTC 2 31 1 ATTCCACCTG 0.976044 -109 TCCACCTGAAATTGCGTCTGATTTCCTTTG 2 43 1 ATTGCGTCTG 0.995962 -97 ATTGCGTCTGATTTCCTTTGAAATTCTATC 2 53 1 ATTTCCTTTG 0.954505 -87 ATAAAGCCTTATTGAGTTTGAGAGGTAAAC 2 98 0 ATTGAGTTTG 0.941084 -42 GGCTTTATGCATTCCCTCAGCAAATCTGCT 2 120 1 ATTCCCTCAG 0.992493 -20 ********** Masking position 3 Map Score: 5.24654 Number of sites scoring better than the average of aligned sites = 384 Number in coding regions = 356 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 3 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0