AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i033_Pyruvate_Synthase_1_aful_reg_100.orf -o033_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG30894 126 Archaeoglobus_fulgidus #2 RAG43044 36 Archaeoglobus_fulgidus #3 RAG31360 125 Archaeoglobus_fulgidus Motif number 1 CTTTGCGTTGAGAACTGCCCCACTAAGGCAGTCAA 1 29 1 AAACTCCCTA 0.98355 -98 AAGGCAGTCAAAATCTACCACGGTAAGCCAGTCAT 1 53 1 AATCTCCCTA 0.991303 -74 AAACCTTTGAACATATTTCACAGTATATACACTTG 1 97 0 AATATTCCTA 0.963016 -30 GGAAAAAGGAAAAAATGCAAATATATTTGCTTTTC 2 12 0 AAAATCAATA 0.797162 -25 TACGTATTGTTTAAATACAACAAAAACAAATAGTT 3 16 0 TAAATCACAA 0.797543 -110 TTTAAACAATACGTATGCCTCAATAGTTGATGTAT 3 36 1 AGTATCCCTA 0.991303 -90 TCAATAGTTGATGTATTCATCTGAAGGGTTGGGAG 3 55 1 AGTATCACAA 0.958824 -71 AATCTTTCCTATATATTACTCCCAACCCTTCAGAT 3 73 0 AATATACCAA 0.941967 -53 GTTTAAATATTCCGCATGAAATTTTATAA 3 107 0 AATATCCCGA 0.988407 -19 * **** ** * ** Masking position 6 Map Score: 7.64541 Number of sites scoring better than the average of aligned sites = 309 Number in coding regions = 271 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 GGCAGTTCTCAACGCAAAGTCTGCACTCTA 1 18 0 AACGCAAAGT 0.935635 -109 GTCATCGACGAAAGCAAGTGTATATACTGT 1 83 1 AAAGCAAGTG 0.952285 -44 CGAAAAGCAAATATATTTGCATT 2 4 1 AAAGCAAATA 0.991814 -33 GGAAAAAGGAAAAAATGCAAATAT 2 23 0 AAAGGAAAAA 0.961633 -14 AAATACAACAAAAACAAATAGTTTATCA 3 9 0 AAAACAAATA 0.949353 -117 GGAGTAATATATAGGAAAGATTTATAAAAT 3 86 1 ATAGGAAAGA 0.944027 -40 ********** Masking position 6 Map Score: 3.33519 Number of sites scoring better than the average of aligned sites = 281 Number in coding regions = 236 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 3 CTGCCCCACTAAGGCAGTCAAAATCTACCA 1 43 1 AAGGCAGTCA 0.994081 -84 CTACCACGGTAAGCCAGTCATCGACGAAAG 1 67 1 AAGCCAGTCA 0.996769 -60 TCATCGACGAAAGCAAGTGTATATACTGTG 1 84 1 AAGCAAGTGT 0.972096 -43 ********** Masking position 6 Map Score: 1.11315 Number of sites scoring better than the average of aligned sites = 19 Number in coding regions = 17 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0