AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i033_Pyruvate_Synthase_1_aful_reg_300.orf -o033_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG25670 202 Archaeoglobus_fulgidus #2 RAG30894 126 Archaeoglobus_fulgidus #3 RAG43044 36 Archaeoglobus_fulgidus #4 RAG31360 125 Archaeoglobus_fulgidus Motif number 1 TATTGATACATATTGGTTTGTATGGTAAAGT 1 37 0 TATTGGTTTT 0.97785 -166 TTTATAAGCATTTTGGTTGATTTAGCTGTGA 1 71 0 TTTTGGTTGT 0.951493 -132 ACCACCTCCTTTTTTGCTGATGAAGTTAATG 1 104 0 TTTTTGCTGT 0.973825 -99 AATGCAAATATATTTGCTTTTCG 3 3 0 TATTTGCTTT 0.988198 -34 AAAGCAAATATATTTGCATTTTTTCCTTTTT 3 14 1 TATTTGCATT 0.953825 -23 TGATAAACTATTTGTTTTTGTTGTATTTA 4 9 1 TATTTGTTTT 0.981567 -117 ********* * Masking position 4 Map Score: 5.72745 Number of sites scoring better than the average of aligned sites = 75 Number in coding regions = 57 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 ATTCCCCCTCTCTTCATCTCTTGCAACCTCTATGATGC 1 136 0 TCCCTTGCAC 0.993048 -67 TCCGCATCCAACGCATCTCTCTGCGCTG 1 185 0 TCCCCAGCAT 0.995288 -18 CAACGCAAAGTCTGCACTCTATGCACCC 2 1 0 TCCTCAGCAC 0.995288 -126 CGTTGAGAACTGCCCCACTAAGGCAGTCAAAATCTACC 2 34 1 TGCCTAGCAC 0.992524 -93 GGTAAGCCAGTCATCGACGAAAGCAAGTGTATATACTG 2 74 1 TCCCGAGCAT 0.991361 -53 GATGAATACATCAACTATTGAGGCATACGTATTGTTTA 4 38 0 TCCTTAGCAC 0.994915 -88 ** * ** * *** * Masking position 15 Map Score: 5.54439 Number of sites scoring better than the average of aligned sites = 131 Number in coding regions = 120 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 ATCAGGAGTTGGTTAAATAACTTTACCATA 1 18 1 GGTTAAATAA 0.931463 -185 ATGAAGAGAGGGGGAATTACCTGTATTTCA 1 157 1 GGGGAATTAC 0.922874 -46 ATCTCTCTGCGCTGAAATACAGGTAATTCC 1 169 0 GCTGAAATAC 0.969651 -34 ACGAAAGCAAGTGTATATACTGTGAAATAT 2 90 1 GTGTATATAC 0.843988 -37 GTGTATATACTGTGAAATATGTTCAAAGGT 2 100 1 TGTGAAATAT 0.789656 -27 CATACGTATTGTTTAAATACAACAAAAACA 4 23 0 GTTTAAATAC 0.977352 -103 GTTTAAATATTCCGCATGAA 4 116 0 GTTTAAATAT 0.938403 -10 ********** Masking position 5 Map Score: 2.77538 Number of sites scoring better than the average of aligned sites = 290 Number in coding regions = 238 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 4 TCCAACGCATCTCTCTGCGCTGAAATACAG 1 177 0 CTCTCTGCGC 0.987204 -26 TCCGCATCCAACGCATCTCTCTGC 1 189 0 CATCCAACGC 0.972548 -14 GCAAAGTCTGCACTCTATGCACCC 2 5 0 CACTCTATGC 0.958165 -122 AGTGGGGCAGTTCTCAACGCAAAGTCTGCA 2 23 0 TTCTCAACGC 0.979178 -104 CTATATATTACTCCCAACCCTTCAGATGAA 4 70 0 CTCCCAACCC 0.986883 -56 ********** Masking position 5 Map Score: 1.95086 Number of sites scoring better than the average of aligned sites = 360 Number in coding regions = 340 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 5 TGATTTAGCTGTGATAGTATTGATACATATT 1 54 0 GTGATAGATT 0.961928 -149 TATAAGCATTTTGGTTGATTTAGCTGTGATA 1 69 0 TTGGTTGTTT 0.961928 -134 TGCTGATGAAGTTAATGGTTTTATAAGCATT 1 90 0 GTTAATGTTT 0.841818 -113 AAAAAAGGAGGTGGTAGCATCATAGAGGTTG 1 120 1 GTGGTAGATC 0.966097 -83 CTGGCTTACCGTGGTAGATTTTGACTGCCTT 2 53 0 GTGGTAGTTT 0.986136 -74 ACTATTTGTTTTTGTTGTATTTAAACAATAC 4 17 1 TTTGTTGATT 0.94093 -109 TGCCTCAATAGTTGATGTATTCATCTGAAGG 4 51 1 GTTGATGATT 0.962124 -75 ******* *** Masking position 2 Map Score: 4.12364 Number of sites scoring better than the average of aligned sites = 299 Number in coding regions = 259 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 6 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0