AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i035_Sugars_Metabolism_aful_reg_300.orf -o035_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG10014 73 Archaeoglobus_fulgidus #2 RAG02871 72 Archaeoglobus_fulgidus #3 RAG02870 77 Archaeoglobus_fulgidus Motif number 1 CTCGGCTTTAAAGTTATTTTCTAAAAAAGAT 1 26 1 AATTATTTTC 0.985564 -48 AGGAAAATTGAGTTTGGCAAATCAAT 2 6 1 AATGAGTTTG 0.953523 -67 GAGTTCGCCGAATTGATTTGCCAAACTCAAT 2 17 0 AATGATTTGC 0.994111 -56 GATATGTAATAAATTTTTTGGAGTTCGCCGA 2 37 0 AATTTTTTGG 0.982489 -36 TTACGCTAATATCTGTTTTGCTTAACGAAAA 3 26 1 ATTGTTTTGC 0.97655 -52 GCCATTTTAAAATTTTTTTTCGTTAAGCAAA 3 42 0 AATTTTTTTC 0.985564 -36 ** ******** Masking position 4 Map Score: 6.93348 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 73 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 AAAAGATTAAATTTCCCCAAATCGAAGGTAGGT 1 50 1 ATTCCCAATC 0.997297 -24 CGCCGAATTGATTTGCCAAACTCAATTTTCCT 2 10 0 ATTGCCAATC 0.998994 -63 TGGCAAATCAATTCGGCGAACTCCAAAAAATTT 2 25 1 ATTGGCAATC 0.997307 -48 CAAAACAGATATTAGCGTAAATCAAAAAGTCCT 3 13 0 ATTGCGAATC 0.997307 -65 *** *** ** ** Masking position 9 Map Score: 5.70586 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 3 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 TTCGATTTGGGGAAATTTAATCTTTTTTAG 1 46 0 GGAAATTTAA 0.987727 -28 AGGAAAATTGAGTTTGGCAAA 2 2 1 GGAAAATTGA 0.967414 -71 TTACGTCTCCGGATATGTAATAAATTTTTT 2 49 0 GGATATGTAA 0.9874 -24 TTACATATCCGGAGACGTAAGGCC 2 59 1 GGAGACGTAA 0.989876 -14 ********** Masking position 5 Map Score: 2.84849 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 54 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0