AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i057_Chorismate_Biosynthes_aful_reg_300.orf -o057_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG18637 262 Archaeoglobus_fulgidus #2 RAG33372 69 Archaeoglobus_fulgidus #3 RAG33427 35 Archaeoglobus_fulgidus #4 RAG19353 73 Archaeoglobus_fulgidus #5 RAG27692 75 Archaeoglobus_fulgidus Motif number 1 AGGAAGGTTTAGCAGCATGTATTTAAGCTTTTCCA 1 64 0 AGCGCGTTTA 0.994981 -199 TGTAGCCAAAACCAGGGTGTTTGGATTTTATTTTA 1 110 1 ACCGGGTTGA 0.992516 -153 GCTTCTAATTAGCGGGAGGTGTTCTGCAGTGGCTC 1 169 1 AGCGGGTTTT 0.994226 -94 TTAAAAAAAGAGCCGGATGTATTTAAAGCTTGTTC 4 13 1 AGCGGGTTTA 0.998569 -61 AAGGTATTATAGCAGGTTGTGTGAAGAATTAAC 4 51 1 AGCGGGTTGA 0.998274 -23 GGGTTTTCGGAGCGGTAAGTATTTATCCAAAGCGG 5 24 0 AGCGTGTTTA 0.992579 -52 *** ** ** ** * Masking position 10 Map Score: 11.1976 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 11 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 GAAAATTTTTTAAGTTTTAAAAATTGTGAGC 1 15 0 TAAGTTTAAA 0.863812 -248 AGCTTAAATACATGCTGCTAAACCTTCCTCC 1 70 1 CATGCTCTAA 0.951984 -193 TGTATGGGTTTATGCTCTAAAAATATAAGAG 1 212 1 TATGCTTAAA 0.977927 -51 AATTTTGCGACATGTTTCAAATTT 2 4 0 CATGTTCAAA 0.977479 -66 CTATTTGAAATATGTTTCAATAGCAAAGTAT 2 38 0 TATGTTCAAT 0.861404 -32 CCTTTCTGAACAAGCTTTAAATACATCCGGC 4 24 0 CAAGCTTAAA 0.976477 -50 CTTCACACAACCTGCTATAATACCTTTCTGA 4 46 0 CCTGCTTAAT 0.916846 -28 TCATAGTGGTCATGCAGTAAAAAAGGGTTTT 5 52 0 CATGCATAAA 0.953024 -24 ****** **** Masking position 10 Map Score: 6.56175 Number of sites scoring better than the average of aligned sites = 244 Number in coding regions = 217 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 ATGTATTTAAGCTTTTCCAATTTTTGATTT 1 53 0 GCTTTTCCAA 0.946426 -210 AAACACCCTGGTTTTGGCTACACCATGCAT 1 102 0 GTTTTGGCTA 0.987187 -161 TTTAGGTTTAGCTTTGGCTACTGGTTTAGC 1 141 1 GCTTTGGCTA 0.995633 -122 TAAATACTTTGCTATTGAAACATATTTCAA 2 35 1 GCTATTGAAA 0.865279 -35 AAAGTGTGTTGGCAATTGGGTAATA 3 21 0 GTGTTGGCAA 0.96572 -15 ATACTCTGCCGCTTTGGATAAATACTTACC 5 16 1 GCTTTGGATA 0.987187 -60 ********** Masking position 5 Map Score: 5.95047 Number of sites scoring better than the average of aligned sites = 376 Number in coding regions = 348 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 4 TTCCAATTTTTGATTTATCTATCGAAAATT 1 39 0 TGATTTATCT 0.880586 -224 CATTGGAGGAAGGTTTAGCAGCATGTATTT 1 75 0 AGGTTTAGCA 0.981776 -188 CTCCAATGCATGGTGTAGCCAAAACCAGGG 1 97 1 TGGTGTAGCC 0.982818 -166 ATTTTATTTTAGGTTTAGCTTTGGCTACTG 1 134 1 AGGTTTAGCT 0.992153 -129 CTTTGGCTACTGGTTTAGCTTCTAATTAGC 1 152 1 TGGTTTAGCT 0.994905 -111 ********** Masking position 6 Map Score: 6.19801 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 42 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 5 CCAAAGCTAAACCTAAAATAAAATCCAAAC 1 128 0 ACCTAAAATA 0.942306 -135 CATATAAAACACCTCTTATATTTTTAGAGC 1 225 0 ACCTCTTATA 0.973119 -38 TTCTTCTTTTACCTAACATATAAAACACCT 1 241 0 ACCTAACATA 0.960329 -22 ATTCTCACCTCCTATTTGAAATATGT 2 54 0 ACCTCCTATT 0.967754 -16 TCTTCACACAACCTGCTATAATACCTTTCT 4 48 0 ACCTGCTATA 0.981703 -26 ********** Masking position 4 Map Score: 2.1087 Number of sites scoring better than the average of aligned sites = 30 Number in coding regions = 25 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 6 GATTTATCTATCGAAAATTTTTTAAGTTTTAAAAA 1 23 0 TGAATTTTAA 0.973458 -240 GGTTTAGCTTTGGCTACTGGTTTAGCTTCTAATTA 1 145 1 TGCAGTTTAG 0.94571 -118 TATTTAAATTTTGCGACATGTTTCAAATTT 2 6 0 TGCATTTTCA 0.982612 -64 TATGTTTCAATAGCAAAGTATTTAAATTTTGCGAC 2 24 0 TGCATTTTAA 0.988251 -46 CACCTCCTATTTGAAATATGTTTCAATAGCAAAGT 2 40 0 TGAATTTTCA 0.963088 -30 TAAATACATCCGGCTCTTTTTTTAATC 4 3 0 CGCCTTTTAA 0.974428 -71 TAATACCTTTCTGAACAAGCTTTAAATACATCCGG 4 25 0 CGACGTTTAA 0.924703 -49 * ** * * ***** Masking position 11 Map Score: 2.98771 Number of sites scoring better than the average of aligned sites = 125 Number in coding regions = 100 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 7 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0