AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i070_Threonine_Biosynthesis_aful_reg_300.orf -o070_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG01314 41 Archaeoglobus_fulgidus #2 RAG01312 300 Archaeoglobus_fulgidus #3 RAG03096 48 Archaeoglobus_fulgidus Motif number 1 GCAAGAAATATAAATCTTGCTGAG 1 4 0 TAATCTTGCT 0.989334 -38 GCAAGATTTATATTTCTTGCTTAGGGCAGGA 1 15 1 TATTCTTGCT 0.986156 -27 CCTATTTCCTGCCCTAAGCAAGA 1 29 0 TATTCCTGCC 0.963595 -13 CTATCATTGCTCAAGCTTGCTAAATTCAAAT 2 57 0 TCAGCTTGCT 0.971804 -244 AGTGCTGATACCTCTGCTGCTCCCCATAGCC 2 89 1 CCTTGCTGCT 0.967209 -212 CTCGTTCATCCCAGTCTTGCTTTTTGCCCCG 2 134 1 CCATCTTGCT 0.986906 -167 ATGAAAGTTATAAATGCCGCTAAAATTTACT 2 274 1 TAATGCCGCT 0.935664 -27 *** ******* Masking position 9 Map Score: 6.21201 Number of sites scoring better than the average of aligned sites = 290 Number in coding regions = 272 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 TTTACTGACCTCATGAGCATTATCATAACGCTTAAA 2 13 0 TCAAGTTCAT 0.963996 -288 AGCAGAGGTATCAGCACTCCTATCATTGCTCAAGCT 2 71 0 TCAACTTCAT 0.984411 -230 CATAGCCCTCTTAGAACTCGTCTCGTTCATCCCAGT 2 113 1 TTAACTTCGT 0.9911 -188 CCGATGTACCTTCTGGGAAGTGTCGTTTCGCAAAGT 2 162 1 TTCGGTTCGT 0.907744 -139 CCTATGAGGCTCACGGCCAATTCCGTAGAACTTTGC 2 191 0 TCAGCTCCGT 0.990594 -110 TTAGCGGCATTTATAACTTTCATCGTACCCGCTTTA 2 261 0 TTAACCTCGT 0.971952 -40 TTATAAATCTTCAAAACAATTCCCGTC 3 2 0 TCAACTCCGT 0.993632 -47 *** ** * **** Masking position 1 Map Score: 4.04838 Number of sites scoring better than the average of aligned sites = 214 Number in coding regions = 201 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 TTTCTTGCTTAGGGCAGGAAATAGG 1 27 1 AGGGCAGGAA 0.952085 -15 CAATGATAGGAGTGCTGATACCTCTGCTGC 2 79 1 AGTGCTGATA 0.826455 -222 AGGGCTATGGGGAGCAGCAGAGGTATCAGC 2 92 0 GGAGCAGCAG 0.929142 -209 GAGTTCTAAGAGGGCTATGGGGAGCAGCAG 2 102 0 AGGGCTATGG 0.887185 -199 AAGGTACATCGGGGCAAAAAGCAAGACTGG 2 144 0 GGGGCAAAAA 0.977832 -157 TAGGATTCGTGGGGCTGATGTACTACTTTT 2 223 1 GGGGCTGATG 0.992442 -78 TACTTTTTGAGGGGCTAAAGCGGGTACGAT 2 246 1 GGGGCTAAAG 0.99164 -55 ********** Masking position 5 Map Score: 3.87459 Number of sites scoring better than the average of aligned sites = 1604 Number in coding regions = 1529 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 4 TCTTGCTTAGGGCAGGAAATAGG 1 29 1 GGCAGGAAAT 0.987757 -13 TGCTCATGAGGTCAGTAAAGATTAAATATT 2 30 1 GTCAGTAAAG 0.989689 -271 AACCTCAGTAAATTTTAGCGGCA 2 288 0 CTCAGTAAAT 0.983883 -13 GCTGCCAGTAAATCACGCACTTT 3 36 0 GCCAGTAAAT 0.992782 -13 ********** Masking position 4 Map Score: 3.30253 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 6 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 TTTGCGAAACGACACTTCCCAGAAGGTACA 2 166 0 GACACTTCCC 0.994746 -135 GAGGCTCACGGCCAATTCCGTAGAACTTTG 2 192 0 GCCAATTCCG 0.990991 -109 AAATCTTCAAAACAATTCCCGTC 3 4 0 AACAATTCCC 0.988955 -45 ********** Masking position 4 Map Score: 0.528377 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 22 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0