AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i076_Lipopolysaccharide_Biosynthesis_1_aful_reg_100.orf -o076_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG49475 219 Archaeoglobus_fulgidus #2 RAG49513 126 Archaeoglobus_fulgidus Motif number 1 CTTTTTTATTGGCACTCGTCTTGTTTCTGGTTTT 1 18 0 GGCCTCCTTT 0.987675 -202 TTGGAGCCTCTTAGCTCCTTTTTTATTGGCACTC 1 35 0 TTACTCTTTT 0.978977 -185 ACCGAGGCACGGCTCTAGGTTTGATTTGGAGCCT 1 60 0 GGCCTATTTA 0.96275 -160 CCGTGCCTCGGTATCTCTGCTTAAACTCAAATTG 1 82 1 GTACTCCTTA 0.975691 -138 ATGGTGATTATGACATCTCTTTTTCTCAAATATC 1 120 1 TGAATCTTTT 0.899686 -100 TTAAAAACATTGAGCTCAGTCTATGGGTATGTCC 1 155 0 TGACTCTCTT 0.955307 -65 TTAAAAATTTTGCTCTAAGTTTAAAAACATTGAG 1 175 0 TGCCTATTTA 0.952551 -45 AAACGTCTCCGTACCTCCCCTTCTCCGCAAGGAG 2 44 0 GTACTCCTTT 0.980179 -83 AACTCCGTTCTTAGCTACATTTTACTTGCACTCG 2 101 1 TTACTATTTA 0.925218 -26 *** *** *** * Masking position 6 Map Score: 7.2133 Number of sites scoring better than the average of aligned sites = 575 Number in coding regions = 533 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 2 AGCTAAGAGGCTCCAAATCAAACCTAGAGCCG 1 53 1 CTCAATCAAA 0.973866 -167 GGTATCTCTGCTTAAACTCAAATTGAGTCATG 1 91 1 CTTACTCAAA 0.995921 -129 TATGACATCTCTTTTTCTCAAATATCCGGACA 1 128 1 CTTTCTCAAA 0.990222 -92 CTACATTTTACTTGCACTCGAA 2 115 1 CTTACTCGAA 0.993229 -12 *** ******* Masking position 8 Map Score: 1.9719 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 46 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 TAAAAAAGGAGCTAAGAGGCTCCAAATCAA 1 44 1 GCTAAGAGGC 0.97681 -176 TTAAGCAGAGATACCGAGGCACGGCTCTAG 1 76 0 ATACCGAGGC 0.975665 -144 CCCCTTCTCCGCAAGGAGGCAGTAGCCCTT 2 32 0 GCAAGGAGGC 0.996315 -95 AGAAGGGGAGGTACGGAGACGTTTACAACC 2 54 1 GTACGGAGAC 0.986621 -73 ********** Masking position 7 Map Score: 1.14127 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 141 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: -2.60469e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.60469e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.60469e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0